Mol Biol Rep (2010) 37:507–513 DOI 10.1007/s11033-009-9703-3
Characterization of reference genes for quantitative real-time PCR analysis in various tissues of Salvia miltiorrhiza Yanfang Yang Æ Shuang Hou Æ Guanghong Cui Æ Shilin Chen Æ Jianhe Wei Æ Luqi Huang
Received: 28 June 2009 / Accepted: 29 July 2009 / Published online: 13 August 2009 Ó Springer Science+Business Media B.V. 2009
Abstract Five reference genes, 18S, EF1a, a-Tubulin, Ubiquitin and Actin, from Salvia miltiorrhiza were analyzed as internal controls for gene expression profiling assay using quantitative real-time polymerase chain reaction (qRT-PCR). The five candidate genes were measured for their transcriptional level in seven tissues, including roots, stems, leaves, sepals, petals, stamens and pistils. Then they were ranked by the GeNorm tool. The results showed that Actin and Ubiquitin were the most stable whereas EF1a and 18S did not favor normalization of qRTPCR results in these tissues. Expression levels of the SmDXR gene were studied in parallel, with Actin and Ubiquitin both or each as reference in the seven tissues, and varying relative quantifications of the SmDXR gene in seven tissues. This study indicated that selection of the most stable genes plays an important role in gene expression profiling assays. Keywords Reference gene Quantitative real-time PCR Salvia miltiorrhiza DXR
Y. Yang S. Hou S. Chen J. Wei (&) Institute of Medicinal Plant Development, Chinese Academy of Medicinal Sciences and Peking Union Medical College, NO.151, Malianwa North Road, 100193 Hai Dian District, Beijing, China e-mail:
[email protected] G. Cui L. Huang (&) Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences, 100700 Beijing, China e-mail:
[email protected] S. Hou College of Horticultural and Landscape Architecture, Southwest University, 400715 Chongqing, China
Abbreviations DMAPP Dimethylallyl diphosphate DXR 1-Deoxy-D-xylulose 5-phosphate reductoisomerase IPP Isopentenyl diphosphate MEP 2-C-Methyl-D-erythritol 4-phosphate MVA Mevalonate acid PCR Polymerase chain reaction qRT-PCR Quantitative real-time PCR RT Reverse transcription
Introduction Quantitative real-time PCR (qRT-PCR) serves as the most sensitive method for gene expression pattern assay, which plays an important role in the current biological research [1]. However, it has substantial variability in RNA stability, quantity, purity, and the efficiency of reverse transcription (RT) and polymerase chain reaction (PCR), etc. [2]. To avoid the bias thus caused, internal control genes (reference genes) are needed to normalize the mRNA fraction. To achieve this goal, reference genes have to be carefully selected and required to be consistently expressed at similar levels in different cell types or under different treatment [3–6]. Some commonly used reference genes are not consistently stable [3, 7–9]. For example, though 18S rRNA is usually used as an internal control, actually rRNA transcription is affected by biological factors and drugs [10], and requires the total RNA as template and random primers for the RT reaction. Besides, imbalance between rRNA and mRNA fractions exists among different samples [11, 12]. To further investigate the transcripts stability of the
123
508
commonly used reference genes and to identify novel and superior reference genes, it is necessary to collect as many as possible gene expression data for each organism from different organs and under experimental conditions. Moreover, according to Thellin et al. [6] and Vandesompele et al. [13], at least two or three reference genes are required as internal standards because the use of a single gene for normalization would lead to relatively large errors. Studies of reference genes expression mainly focus on human tissues [2, 5, 6, 14], bacteria and viruses [15–17], as well as some plants, such as rice [18], poplars [19], potatoes [20], Arabidopsis [9], soybeans [21] and tomatoes [22]. Salvia miltiorrhiza, Danshen in Chinese, is a highly valued traditional Chinese medicine for the treatment of atherosclerosis-related disorders, such as cardiovascular and cerebrovascular diseases in China [23]. S. miltiorrhiza contains two types of active compounds, tanshinones which are lipophilic, and salvianolic acids which are hydrophilic [24]. Tanshinones, one kind of isoprenoids, have anti-inflammatory, antiischemic, antioxidant, and antitumor functions. The tanshinones precursor, isopentenyl diphosphate (IPP), and its isomers, dimethylallyl diphosphate (DMAPP), are synthesized through 2-Cmethyl-D-erythritol 4-phosphate (MEP) and mevalonate acid (MVA) pathways. 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) commits the catalyzation of the first step of MEP pathway for isoprenoid biosynthesis [25]. DXR has been proved to play an important role in the plasmid isoprenoid biosynthesis, and the SmDXR gene (DQ991431) has been cloned from the hair roots or the plants of S. miltiorrhiza [26, 27]. In this study, Actin and Ubiquitin were selected as the most stable reference genes from various tissues of S. miltiorrhiza, and the expression pattern of SmDXR gene was investigated in parallel. The relative quantification showed that the SmDXR transcripts highly accumulate in stems, petals and pistils (Fig. 3).
Mol Biol Rep (2010) 37:507–513
observed. Nucleic acid concentrations were measured by a Qubit Fluorometer with quant-iT RNA assay kit (Invitrogen, USA). All RNA samples were adjusted to an equal concentration, measured and adjusted again to homogenize RNA input in the subsequent cDNA synthesis reaction. Primer design Six candidate reference genes were selected from the literature for qRT-PCR (Table 1). The primers of Actin and the gene of interest, SmDXR were designed with Primer 3 obtained online (http://frodo.wi.mit.edu/) according to the mRNA sequences of Actin (DQ243702) and SmDXR of S. miltiorrhiza (DQ991431). As the transcripts of EF1b and b-Tubulin could not be detected by PCR with the primers reported [3] in S. miltiorrhiza, these two genes were excluded from further analysis. Verification of amplified products and sequencing reactions
Materials and methods
PCR products were checked on 1.5% agarose gel, and shown to have the expected size. In order to determine the sequences of amplification products, PCRs were performed on the samples with 300 nM primers, 2U Taq DNA polymerase (Takara, Japan), 400 lM each of dNTP mix (Takara, Japan), and 10 ng of cDNA in a total volume of 25 ll. Amplifications were performed with the following program: 94°C for 2 min, followed by 40 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s. PCR products were purified using the Qiaquick PCR purification kit (Tiangen, China) according to the manufacturer’s instructions. Amplified products were cloned into the pGEM-T vector for sequencing according to the manufacturer’s instructions (Promega, USA). The colonies were analyzed by PCR with gene-specific primers (Table 1), and the nucleotide sequences were sequenced by ABI3730 sequencer (Invitrogen, China). The sequences of amplification products were confirmed using BLAST program at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/).
Total RNA extraction and quality control
cDNA synthesis and quantitative real-time PCR
All seven tissues, including roots, stems, leaves, sepals, petals, stamens and pistils, were collected from mature S. miltiorrhiza grown in the natural condition when the inflorescences were just blooming. Total RNA was extracted from these tissues by Trizol method (Invitrogen, USA). RNA was treated with RNase-free DNase I according to the manufacturer’s instruction (Takara, Japan), and the purity of RNA was assessed by 1.5% agarose gel electrophoresis, with no degradation was
With 100 ng of the isolated RNA, the first strand cDNA was synthesized with purified total RNA using the RT PCR system (Promega, USA) according to the manufacturer’s protocol. The oligo(dT)18 and random primers were used as the primers and the RT reaction was carried out at 37°C for 1 h in a total volume of 20 ll. The qPCR assays were performed in an optional 96-well plate with Bio-Rad iQ5 system (Bio-rad, USA) and a commercial SYBR-Green master mix kit (Takara, Japan),
123
Mol Biol Rep (2010) 37:507–513
509
Table 1 Description of reference genes and SmDXR gene, as well as the primer sequences for qRT-PCR Gene name
Function
18S
18S Ribosomal RNA
Primer sequences (50 ? 30 )
Length (bp)
Literature
(F) CTTCGGGATCGGAGTAATGA
233
Leple´ et al. [28]
497
Yang et al. [29]
278
–
146
Rajinikanth et al. [30]
466
Chang et al. [31]
(R) GCGGAGTCCTAGAAGCAACA EF1a
Elongation factor 1 alpha
Actin
Cytoskeletal structural protein
(F) AGACCACCAAGTACTACTGCAC (R) CCACCAATCTTGTACACATCC (F) AGGAACCACCGATCCAGACA (R) GGTGCCCTGAGGTCCTGTT
Ubiquitin
Ubiquitin protein
(F) GTTGATTTTTGCTGGGAAGC (R) GATCTTGGCCTTCACGTTGT
a-Tubulin
Cytoskeletal structural protein
(F) AGAACACTGTTGTAAGGCTCAAC
EF1b
Elongation factor 1 beta
(F) AAGAGGACAAGAAGGCAGCA (R) CTAACCGCCTTCTCCAACAC
–
Rajinikanth et al [30]
b-Tubulin
Tubulin beta-9 chain
(F) GCACCAACTTGTTGAGAATGC
–
Rajinikanth et al. [29]
259
Wu SJ et al. [26]
(R) GAGCTTTACTGCCTCGAACATGG
(R) TTTCAACTGACCAGGGAACC SmDXR
1-Deoxy-D-xylulose 5-phosphate reductoisomerase
(F) GAGAATCTACTGCTCCGAGA (R) CTGGTCGTAGTGGATGATCT
according to the manufacturer’s instruction. The identical qPCR protocol was adopted for all qPCR assays in all samples: after incubation at 95°C for 3 min to activate the DNA polymerase, 40 cycles of 95°C for 30 s and 58°C for 20 s each were performed to facilitate the PCR reaction. Data acquisition occurred at real time during the annealing/ elongation incubation at 58°C. After qPCR, a melt curve was generated by heating the samples from 55 to 95°C in 0.5°C steps, each of which lasted 10 s and meanwhile data acquisition was performed at real time. In the experiment of choosing the suitable reference genes, all samples were amplified in duplicate from the same RNA preparation and the mean value was obtained. The qRT-PCR was performed using two independent sets of RNA samples that yielded similar results. SmDXR gene expression data were analyzed by Bio-Rad iQ5 Optical System Software version 2.0 as shown as the mean ± SD of three determinations for each sample. Primer efficiencies and standard deviations were calculated based on a standard curve generated using a fourfold dilution series over at least four dilution points that were measured in triplicate. Expression levels of each sample were calculated based on three technical replicates, which took into account the primer efficiency.
were followed to calculate instability values of gene expression. The expression data of SmDXR were analyzed by BioRad iQ5 Optical System Software version 2.0 (Gragh error ± SD = 0.1) and shown as the mean ± SD of three determinations for each sample.
Results Sequences analysis The sequences of 18S, EF1a, Actin, Ubiquitin and a-Tubulin, were obtained from S. miltiorrhiza, respectively with the lengths of 233, 497, 278, 146 and 466 bp. BLASTn analysis revealed that these genes had 82–98% identities with homology genes from other species. For example, 18S had 98% identity with that of Agrostistachys borneensis, EF1a had 89% identity with that of Arabidopsis EF1a gene (GenBank No. AF360167), and the a-Tubulin had 82% identity with that of the Populus trichocarpa Tubulin a-6 (GanBank No. XM_002319652). The gene of interest, SmDXR was also obtained, which was 259 bp long and had 95% identity with the S. miltiorrhiza DXR gene (GenBank No. DQ991431). Establishment of qPCR assays
Statistical analyses Following PCR data collection, a publicly available Visual Basic for Microsoft Excel, called GeNorm [13], was used to rank the expression variability of reference genes in all samples. The procedures outlined in the user’s manual (http:// medgen.ugent.be/*jvdesomp/genorm/geNorm_manual.pdf)
Different sequences were amplified with different efficiencies, causing under/overestimation of input template copy numbers in orders of magnitude. The amplification efficiency of the six selected primer pairs was confirmed by amplifying cDNA derived from root RNAs. All the six qPCR assays yielded specific products with expected
123
510
Mol Biol Rep (2010) 37:507–513
sequences, and the qRT-PCR efficiency of all assays was between 95 and 102% (data not shown). Variations of reference genes The raw expression levels of the five reference genes are shown in Fig. 1. 18S had the highest expression level with the low Ct value, and had the significant change in leaves and sepals. Actin and Ubiquitin had relatively stable expression levels in all seven tissues, along with highly similar regression lines. EF1a and a-Tubulin had higher Ct values than the other three candidate genes, and they had significant changes in roots, stems and pistils compared with the other four tissues. Selection of internal controls GeNorm analysis was used to confirm the best reference genes selected from the five reference genes of the seven tissues. The reference gene with the highest M value (average expression stability) was stepwise omitted, and average expression stability values were subsequently recalculated for the remaining control genes in ref. [13]. The results showed that Actin and Ubiquitin with the low M value were the most stable genes, while EF1a and 18S had the lowest expression stabilities in the seven tissues (Fig. 2). SmDXR expression in the seven tissues The SmDXR gene had higher expression levels in all aerial tissues than in the underground parts, and in the aerial tissues in the order of stems [ petals and pistils [ sepals and stamens (Fig. 3a). Compared with the combination use of Actin and Ubiquitin, using Actin or Ubiquitin alone as the unique internal control, did not significantly change the quantification of the expression level of SmDXR in these tissues, expect for petals and sepals (Fig. 3b, 3c). The expression level of SmDXR in petals was higher than that in
Fig. 1 RNA transcription levels of the five tested reference genes in different tissues presented as the Ct mean value
123
Fig. 2 Average expression stability values of control genes by GeNorm analysis. The M value was defined to measure gene expression stability. The higher the M value, the lower the stability. The least stable genes are displayed on the left, and the most stable genes on the right
sepals using Actin as the reference gene (Fig. 3b), but an opposite result was obtained when using Ubiquitin as the internal control (Fig. 3c).
Discussion It has been generally accepted that selection of suitable reference genes is a prerequisite for the success of geneexpression profiling research. In the present transcriptionprofiling experiments of S. miltiorrhiza, five widely used reference genes from various tissues were analyzed for the subsequent determination of the best set for use in the panel of gene-expression experiments. The results indicated that Actin and uibiquitin are the most suitable candidate genes to serve as the internal control for tissues expression analysis in S. miltiorrhiza. Much work has indicated that any single reference gene may satisfy the whole or most experimental conditions. Although being capable of normalizing the expression quantification, the Actin gene is not the best gene for varying expressions in different treatments of potato [20]. Expo´sito-Rodrı´guez et al. suggested that the usage of a-Tubulin as the control gene should be avoid because its expression stability is far from acceptable, despite they had been previously described as ‘‘candidate controls’’ in tomato plants [24, 32]. Ubiquitin10 is stably expressed in Arabidopsis, whereas it is not suitable for normalization of different tissues at different developmental stages in rice and soybeans [21, 33, 34]. Therefore, confirming Actin and Ubiquitin as the suitable reference genes is very necessary for the tissues expression study in S. miltiorrhiza. The expression level of SmDXR gene in different tissues normalized with Actin and Ubiquitin as the internal control showed similar profiles to those obtained with Actin and Ubiquitin as reference gene, respectively, but significant differences were observed in petals and sepals. Because the
Mol Biol Rep (2010) 37:507–513
511
Fig. 3 The SmDXR expression pattern using a Actin and Ubiquitin in combination, b Actin alone as the internal control and c Ubiquitin alone as internal control. Analysis with GeNorm showed that Actin and Ubiquitin were the most stable reference genes
conventional normalization strategy based on a single gene might lead to erroneous normalization [6, 13, 20], Thellin et al. recommended usage of at least two reference genes as internal standards for comparison of gene expression levels with references genes transcripts [6]. Here two suitable genes, Actin and Ubiquitin, were used in combination as the internal control. This would serve as a reliable measure in the tissue expression analysis in S. miltiorrhiza. SmDXR, as a key control enzyme, catalyzes the first committed step of the MEP pathway for isoprenoid biosynthesis. In this study, tissue expression pattern analysis indicated that SmDXR was expressed in all tissues, especially strongly expressed in stems, petals and pistils. These results were similar with the DXR gene expression profile in Arabidopsis [35]. The higher transcripts of the DXR gene have also been observed in leaves or stems of some medicinal plants, such as Ginkgo biloba and Camptotheca acuminate [36, 37]. Carretero-Paulet et al. supposed that the higher expression of DXR was due to various uncharacterized isoprenoids in inflorescences in Arabidopsis [35]. As well as known, there are great numbers of isoprenoids compounds, such as tanshinones, in the roots of S. miltiorrhiza, but this study showed that the SmDXR gene is lowly expressed in roots there. In plants, the plastidlocalized MEP pathway provides the precursors of isoprenoid hormones, monoterpenes, carotenoids and the side chain of chlorophylls, tocopherols and prenylquinones [38]. The inhibition of the DXR activity leads to the decrease in carotenoid contents in tomato fruits [39]. With
color complementation assay, SmDXR has been shown to play an important role in promoting carotenoids (lycopene) pathway flux [27]. The present study also suggested that SmDXR catalyzes the MEP pathway in a complicated way. It not only decides the tanshinones but also is related with the many metabolism flux in S. miltiorrhiza. The function of SmDXR needs to be further investigated in more aspects with different methods. In conclusion, for the quantification of SmDXR gene expression, the selection of content internal controls is necessary and important in normalizing the tissue expression level. In this study, the expression data of five reference genes were analyzed, showing that Actin and Ubiquitin remained unchanged in different tissues or organs, and 18S and EF1a could not favor normalization as the inter control. The results indicated that Actin and Ubiquitin are the suitable reference genes and may help to normalize genes tissues expression pattern of S. miltiorrhiza. Acknowledgments This work was supported by The Special Funds in Basic Scientific Research for Non-Profit Research Institutes financed by the Ministry of Finance People’s Republic of China (No. YZ-08-19).
References 1. Bustin SA (2002) Absolute quantification of mRNA using realtime reverse transcription polymerase chain reaction assays. J Mol Endocrinol 25:169–193 2. Mahoney DJ, Carey K, Fu MH, Snow R, Cameron-Smith D, Parise G, Tarnopolsky MA (2004) Real-time RT-PCR analysis of
123
512
3.
4.
5.
6.
7. 8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Mol Biol Rep (2010) 37:507–513 housekeeping genes in human skeletal muscle following acute exercise. Physiol Genomics 18:226–231 Thellin O, Zorzi W, Lakaye B, De Borman B, Coumans B, Hennen G, Grisar T, Igout A, Heinen E (1999) Housekeeping genes internal standards: use and limits. J Biotechnol 75:291–295 Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M (2000) Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes. Physiol Genomics 2:143–147 Stu¨rzenbaum SR, kille P (2001) Control genes in quantitative molecular biological techniques: the variability of invariance. Comp Biochem Physiol B 130:281–289 Radonic A, Thulke S, Mackay IM, Landt O, Siegert W, Nitsche A (2004) Guideline to reference gene selection for quantitative realtime PCR. Biochem Biophys Res Commun 313:856–862 Suzuki T, Higgins PJ, Crawford DR (2000) Control selection for RNA quantitation. Biotechniques 29:332–337 Lee PD, Sladek R, Greenwood CMT, Hudson HJ (2001) Control genes and variability: absence of ubiquitous reference transcripts in diverse mammalian expression studies. Genome Res 12: 292–297 Czechowski T, Stitt M, Altmann T, Udvardi MK, Scheible WR (2005) Genomewide identification and testing of superior reference genes for transcript normalization in Arabidopsis. Plant Physiol 139:5–17 Spanakis E (1993) Problems related to the interpretation of autoradiographic data on gene expression using common constitutive transcripts as controls. Nucleic Acids Res 21:3809–3819 Brunner AM, Busov VB, Strauss SH (2004) Poplar genome sequence: functional genomics in an ecologically dominant plant species. Trends Plant Sci 9:49–56 Bustin SA (2002) Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J Mol Endocrinol 29:23–39 Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3(7):research0034.1–research 0034.11 Schmittgen TD, Zakrajsek BA (2000) Effect of experimental treatment on housekeeping gene expression: validation by realtime, quantitative. J. Biochem. Biophys Method 46:69–81 Sto¨cher M, Leb V, Berg J (2002) A convenient approach to the generation of multiple internal control DNA for a panel of realtime PCR assays. J Virol Methods 108:1–8 Sto¨cher M, Leb V, Ho¨lzl G, Berg J (2002) A simple approach to the generation of heterologous competitive internal controls for real-time PCR assays on the lightcycler. J Clin Virol 25:S47–S53 Savli H, Karadenizli A, Kolayli F, Gundes S, Ozbek U, Vahaboglu H (2003) Expression stability of six housekeeping genes: a proposal for resistance gene quantification studies of Pseudomonas aeruginosa by real-time quantitative RT-PCR. J Med Microbiol 52: 403–408 Kim BR, Nam HY, Kim SU, Kim SI, Chang YJ (2003) Normalization of reverse transcription quantitative-PCR with housekeeping genes in rice. Biotechnol Lett 25:1869–1872 Brunner AM, Yakovlev IA, Strauss SH (2004) Validating internal controls for quantitative plant gene expression studies. BMC Plant Biol 4:14 Nicot N, Hausman JF, Hoffman L, Evers D (2005) Housekeeping gene selection for real-time RT-PCR normalization in potato during biotic and abiotic stress. J Exp Bot 56(421):2907–2914 Libault M, Thibivilliers S, Bilgin DD, Radwan O, Benitez M, Clough SJ, Stacey G (2008) Identification of four soybean reference genes for gene expression normalization. Plant Genome 1(1):44–54
123
22. Expo´sito-Rodrı´guez M, Borges AA, Borges-Pe´rez A, Pe´rez JA (2008) Selection of internal control genes for quantitative realtime RT-PCR studies during tomato development process. BMC Plant Biol 8:131 23. Han JY, Fan JY, Horie Y, Miura S, Cui DH, Ishii H, Hibi T, Tsuneki H, Kimura I (2008) Ameliorating effects of compounds derived from Salvia miltiorrhiza root extract on microcirculatory disturbance and target organ injury by ischemia and reperfusion. Pharmacol Ther 117:280–295 24. Zhou LY, Zhu XX (2005) Progresses in studies of the pharmacokinetics of Danshen and its chemical components. Chinese J Exptl Tradit Med Formul 11(3):66–69 25. Kim SM, Kuzuyama T, Chang YJ, Song KS, Kim SU (2006) Identification of class 2 1-deoxy-D-xylulose 5-phosphate synthase and 1-deoxy-D-xylulose 5-phosphate reductoisomerase genes from Gingo biloba and their transcription in embryo culture with respect to ginkgolide biosynthesis. Planta Med 72:234–240 26. Wu SJ, Shi M, Wu JY (2009) Cloning and characterization of the 1-deoxy-D-xylulose 5-phosphate reductoisomerase gene for diterpenoid tanshinone biosynthesis in Salvia miltiorrhiza (Chinese sage) hairy roots. Biotechnol Appl Biochem 52:89–95 27. Yan XM, Zhang L, Wang J, Liao P, Zhang Y, Zhang R, Kai GY (2009) Molecular characterization and expression of 1-deoxy-Dxylulose 5-phosphate reductoisomerase (DXR) gene from Salvia miltiorrhiza. Acta Physiol Plant. doi: 10.1007/s11738-009-0320-5 28. Leple´ JC, Dauwe R, Morreel K, Storme V, Lapierre C, Pollet B, Naumann A, Kang KY, Kim H, Ruel K, Lefe`bvre A, Joseleau JP, Grima-Pettenati J, Rycke RD, Andersson-Gunnera˚s Sara, Erban A, Fehrle I, Petit-Conil M, Kopka J, Polle A, Messens E, Sundberg B, Mansfield SD, Ralph J, Pilate G, Boerjan W (2007) Down regulation of cinnamoyl-coenzyme a reductase in poplar: multiple-level phenotyping reveals effects on cell wall polymer metabolism and structure. Plant Cell 19:3669–3691 29. Yang YF, Wu J, Zhu K, Liu LQ, Chen FD, Yu DY (2009) Identification and characterization of two chrysanthemum (Dendronthema 9 moriforlium) DREB genes, belonging to the AP2/ EREBP family. Mol Biol Rep 36:71–81 30. Rajinikanth M, Harding SA, Tsai CJ (2007) The glycine decarboxylase complex multienzyme family in Populus. J Exp Bot 58(7):1761–1770 31. Chang SH, Ying J, Zhang JJ, Su JY, Zeng YJ, Tong YP, Li B, Li ZS (2003) Expression of a Wheat S-like RNase (WRN1) cDNA during natural- and dark-induced senescence. Acta Botanica Sinica 45(9):1071–1075 32. Coker JS, Davies E (2003) Selection of candidate housekeeping controls in tomato plants using EST data. Bio Techniques 35: 740–748 33. Jain M, Nijhawan A, Tyagi AK, Khurana JP (2006) Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem Biophys Res Commun 345:646–651 34. Jian B, Liu B, Bi Y, Hou W, Wu C, Han T (2008) Validation of internal control for gene expression study in soybean by quantitative real-time PCR. BMC Mol Biol 9:59 35. Carretero-Paulet L, Ahumada I, Cunillera N, Rodrı´guez-Concepcio´n M, Ferrer A, Boront A, Campos N (2002) Expression and molecular analysis of the Arabidopsis DXR gene encoding 1deoxy-D-xylulose 5-phosphate reductoisomerase, the first committed enzyme of the 2-C-methyl-D-erythritol 4-phosphate pathway. Plant Physiol 129:1581–1591 36. Gong YF, Liao ZH, Chen M, Zuo KJ, Guo L, Tan QM, Huang ZS, Kai GY, Sun XF, Tan F, Tang KX (2005) Molecular cloning and characterization of a 1-deoxy-D-xylulose 5-phosphate reductoisomerase gene from Ginkgo biloba. DNA Seq 16(2):111–120 37. Yao H, Gong Y, Zuo K, Ling H, Qiu C, Zhang F, Wang Y, Pi Y, Liu X, Sun X, Tang K (2008) Molecular cloning, expression
Mol Biol Rep (2010) 37:507–513 profiling and functional analysis of a DXR gene encoding 1deoxy-D-xylulose 5-phosphate reductoisomerase from Camptotheca acuminata. J plant physiol 165(2):203–213 38. Phillips MA, Leo´n P, Boronat A, Rodrı´guez-Concepcio´n M (2008) The plastidial MEP pathway: unified nomenclature and resources. Trends Plant Sci 3(12):619–623
513 39. Rodrı´guez-Concepcio´n M, Ahumada I, Diez-Juez E, SauretGu¨eto S, Lois LM, Gallego F, Carretero-Paulet L, Campos N, Boronat A (2001) 1-deoxy-D-xylulose 5-phosphate reductoisomerase and plasmid isoprenoid biosynthesis during tomato fruit ripening. Plant J 27(3):213–222
123