Hepatol Int (2014) 8:250–259 DOI 10.1007/s12072-013-9500-x

ORIGINAL ARTICLE

Clinical significance of increased expression of Nijmegen breakage syndrome gene (NBS1) in human primary liver cancer Yan Wang • Man Li • Jiang Long • Xiao-Yan Shi Qian Li • Jia Chen • Wei-Min Tong • Ji-Dong Jia • Jian Huang

•

Received: 19 February 2013 / Accepted: 26 November 2013 / Published online: 29 January 2014 Ó Asian Pacific Association for the Study of the Liver 2014

Abstract Purpose As a DNA repair-associated gene essential for maintaining genomic instability, Nijmegen breakage syndrome gene (NBS1), codes for a protein, Nbs1(p95/Nibrin), involved in the processing/repair of DNA double-strand breaks. The aim of this study is to investigate the molecular alteration of Nbs1 in human primary liver cancer, including HBV-associated hepatocellular carcinoma (HCC) and intrahepatic cholangiocarcinoma (ICC).

Yan Wang and Man Li have contributed equally to this work.

Electronic supplementary material The online version of this article (doi:10.1007/s12072-013-9500-x) contains supplementary material, which is available to authorized users. Y. Wang  J.-D. Jia (&)  J. Huang (&) Liver Research Center, Beijing Friendship Hospital, Capital Medical University, 95 Yong An Road, Beijing 100050, China e-mail: [email protected] J. Huang e-mail: [email protected] M. Li  W.-M. Tong Department of Pathology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, China J. Long Minimally Invasive Hepatobiliary Cancer Center, Beijing You-An Hospital, Capital Medical University, Beijing, China X.-Y. Shi Department of Pathology, Beijing Friendship Hospital, Capital Medical University, Beijing, China Q. Li  J. Chen Department of Oncological Science, Mount Sinai School of Medicine, New York, NY, USA

123

Methods The expression levels of Nbs1 in 110 cases of primary liver cancer, including 85 HCCs and 25 ICCs, were detected by immunohistochemistry, real-time RTPCR and Western blot analysis. The percentage of Ki-67 antigen-positive cells and the level of phosphorylated histone H2AX (c-H2AX) were detected to evaluate the relationship of Nbs1 expression with proliferation and the degree of DNA damage in HCC cells. Results Increased Nbs1 expression was observed in tumor compared to corresponding adjacent non-tumor tissue in 54.6 and 47.3 % of HCC cases detected with frozen tissues and paraffin sections. Higher frequency of increased Nbs1 expression was shown in poorly differentiated HCCs (p = 0.0265) and in all poorly differentiated ICCs, indicating the increased Nbs1 expression is associated with the degree of malignancy of HCC cells. Moreover, the percentage of Ki-67-positive cells and the level of c-H2AX correlate well with increased Nbs1 expression in HCC cases, suggesting an activated DNA damage response in proliferating HCC cells with increased Nbs1 expression. Conclusion Increased Nbs1 expression might play a significant role in liver cancer progression, and the status of Nbs1 expression might be helpful for evaluation of the degree of malignancy of primary liver cancer. Keywords Hepatocellular carcinoma  DNA repair  Nbs1 expression  Proliferation  Double-strand breaks

Introduction Primary liver cancer is the second most common cancer in Asia and the third leading cause of cancer death worldwide. In 2002, the global number of new cases in males was estimated to be 442,119; there were 416,882 deaths,

Hepatol Int (2014) 8:250–259

251

downstream molecules including p53, BRCA1 and Chk2 to control cell cycle progression [4, 10, 11]. Thus, Nbs1 plays crucial roles in ATM-dependent DNA damage responses. Accumulating evidence suggests a role of Nbs1 in tumorigenesis. In addition to lymphoma and leukemia in NBS patients, NBS1 mutations have been found in sporadic cancers, including breast cancer [12], colorectal cancer [13], medulloblastoma [14], primary glioblastomas [15], lymphoid malignancies and acute lymphoblastic leukemia [16, 17]. Altered expression of the Nbs1 has also been observed in tumors, and the results of several studies indicated that both reduced and increased levels of Nbs1 protein may contribute to tumorigenesis [18–21]. In NBS patients, the amount of the 70-kDa c-terminal fragment of Nbs1 is correlated with cancer occurrence. Significantly more patients with low 70-kDa Nbs1 levels in their lymphoblastoid cell lines developed cancer (in most cases lymphomas) when compared with patients with high 70-kDa Nbs1 expression [19]. In cancer patients without NBS, low expression of Nbs1 was also observed in 46/99 (46 %) of breast carcinomas [18]. On the other hand, increased levels of Nbs1 were observed in tumors as well. Increased Nbs1 expression is present in 45 % of advanced head and neck squamous cell carcinoma (HNSCC) patients receiving non-surgical treatment and is associated with a worse prognosis [20]. A similar finding was obtained in oral squamous cell carcinoma (OSCC) [21]. The dual effects of Nbs1 expression levels on tumorigenesis suggest diverse roles of Nbs1 in the development and progression

94 % of which occurred in the first year after diagnosis [1]. Primary liver cancer comprises mainly hepatocellular carcinoma (HCC; about 90 %) and intrahepatic cholangiocarcinoma (ICC; 5–15 %) [1, 2]. Multiple risk factors of HCC, including hepatitis B virus (HBV) and hepatitis C virus infection, aflatoxin contamination, alcohol abuse, ionizing radiation and human metabolic products toxic to the human genome, can cause DNA damage such as double-strand breaks (DSBs), singlestrand breaks and point mutation in hepatocytes [3]. DNA repair is essential when DNA damage occurs; defects in this process may lead to fatal conditions such as chromosomal instability syndromes and cancer [3–5]. Nijmegen breakage syndrome (NBS), caused by a germline mutation (657del5) in the NBS1 gene, is an autosomal recessive chromosomal instability syndrome characterized by predisposition to cancer, especially leukemia and lymphoma [6, 7]. The product of the NBS1 gene, Nbs1(p95/Nibrin), is a component of the Mre11/Rad50/ Nbs1 (MRN) complex, which is localized in the nucleus and acts as a DNA DSBs sensor and functions in the cell cycle checkpoint in response to DNA damage [5]. Following DSBs in DNA, Nbs1 interacts with phosphorylated histone H2AX (c-H2AX) and is responsible for nuclear translocation of the Mre11/Rad50 repair complex to sites of DNA damage where it senses DNA strand breaks and activates ataxia telangiectasia mutated (ATM) [8, 9], which is central to the DSBs response in mammalian cells. In addition, Nbs1 is phosphorylated by ATM, activating

Table 1 Summary of clinicopathological characteristics of patients with HCC or ICC

Characteristic

Tumor cases for immunohistochemistry analysis HCC (%)

ICC (%)

PLC (%)

Case number

79

25

104

Mean age (range)

52.4 (22–80)

54.6 (32–81)

52.9 (22–81)

Male

68 (86.1 %)

20 (80.0 %)

88 (84.6 %)

Female

11 (13.9 %)

5 (20.0 %)

16 (15.4 %)

40 (50.6 %) 39 (49.4 %)

7 (28.0 %) 18 (72.0 %)

47 (45.2 %) 57 (54.8 %)

Positive

61 (77.2 %)

14 (56.0 %)

75 (72.1 %)

Negative

18 (22.8 %)

11 (44.0 %)

29 (27.9 %)

Well

14 (17.7 %)

2 (8.0 %)

16 (15.4 %)

Moderate

43 (54.4 %)

17 (68.0 %)

60 (57.7 %)

Poor

22 (27.9 %)

6 (24.0 %)

28 (26.9 %)

IHC level ??

38 (48.1 %)

20 (80.0 %)

58 (55.8 %)

IHC level 0 to ?

41 (51.9 %)

5 (20.0 %)

46 (44.2 %)

Gender

Tumor stage Stage 1 [Stage 1 HBV infection

Differentiation

HCC hepatocellular carcinoma, ICC intrahepatic cholangiocarcinoma, PLC primary liver cancer

Nbs1 expression

123

252

of tumors. However, little is known regarding Nbs1 expression in primary liver cancer. Notably, it was reported recently that heterozygous NBS1 mice exhibited a higher incidence of HCC than did wild-type mice (http://escholarship.org/uc/item/16t4k4cd). Other research has shown that mice heterozygous for NBN (the murine homolog of NBS1) developed HCC in addition to lymphomas [22]. This has raised the question of whether Nbs1 plays a role in the pathogenesis of human primary liver cancer, especially HBV-associated HCC. To explore the role of Nbs1 in primary liver cancer, we analyzed the alteration of Nbs1 expression and its clinical significance in primary liver cancer. To clarify the underlying mechanism, we also investigated the relationship of Nbs1 expression with the degree of proliferation and DNA DSBs in HCC by detection of the positive rate of Ki-67 antigen (Ki-67) and the level of c-H2AX.

Hepatol Int (2014) 8:250–259

Hepatobiliary Cancer Center, Beijing You-An Hospital. One hundred four tumors were fixed in buffered formalin and embedded in paraffin; 56 tumors had paired adjacent non-tumor tissues, in which 17 paired frozen tissues were available. Another six pairs of frozen HCCs not prepared as paraffin-embedded sections were also included in the study. The patients were diagnosed as follows: (1) HCC or ICC; (2) with or without HBV infection, determined by positivity or negativity for hepatitis B surface antigen; (3) tumor stage 1 (corresponding to TNM stage I, T1N0M0, as classified by the Union for International Cancer Control) or [1; (4) well, moderately or poorly differentiated tumor, classified according to the World Health Organization Classification of Tumors of the Digestive System [1] (Table 1). Real-time reverse transcriptase PCR

Materials and methods Tissue samples One hundred ten primary liver cancer patients, 85 males (85.5 %) and 25 females (14.5 %), aged 22–81 years with a median age of 52.9 years, were enrolled in this study. The patients underwent surgical treatment between January 2005 and December 2010 at the Liver Research Center, Beijing Friendship Hospital, Capital Medical University, Department of Hepatology, Tianjin Infectious Disease Specialty Hospital and the Minimally Invasive

Fig. 1 NBS1 mRNA and protein expression in tumor (T) and adjacent non-tumor tissue (N). A NBS1 mRNA expression of one representative HCC case (case 478) analyzed by real-time reverse transcriptase PCR. B Representative IHC of Nbs1 expression in tumor and adjacent non-tumor tissue of one HCC case (case 478). The normal hepatocytes showed no or weak nuclei staining of Nbs1. Scattered infiltrating cells showed nuclei-positive staining for Nbs1. The scale bars represent 50 lm in each panel. C Five representative pairs of tumor cases were subjected to Western blot analysis to determine Nbs1 expression

123

One hundred milligrams of fresh frozen tissue was homogenized in 1 ml of TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and total RNA was extracted according to the manufacturer’s instructions. The mRNA was then reverse transcribed to cDNA using a reverse transcription kit (Promega, San Luis Obispo, CA, USA). Quantitative real-time PCR was performed on an ABI Prism 7300 Sequence Detector (Applied Biosystems). The amount of target, normalized to an endogenous reference [(TATA box binding protein (TBP)], was calculated as 2-DDCt, as determined by the ABI Prism 7300 system software’s built-in algorithm using an adaptive baseline to

Hepatol Int (2014) 8:250–259

determine the Ct value. The relative amounts were expressed as the mean ± standard deviation of three independent experiments. The sequences of the primers were as follows: ATGGAGGCCATATTTCCATGAC and CAAGCAGCCAGAACTTGGAAG for the NBS1 gene and TGGTGGTGTTGTGAGAAGATGG and CGGTGGGCA CTTACAGAAGG for TBP. Western blot One hundred milligrams of frozen tissue was lysed and clarified by centrifugation. The protein concentration was determined using a BCA kit (Pierce, Rockford, IL, USA). Eighty micrograms of each protein extract was loaded onto 10 % SDS-PAGE gel and transferred to nitrocellulose membrane. The membrane was probed with primary antibody against Nbs1 (Abcam, Cambridge, MA, USA), CCNB2 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), PCNA (Santa Cruz, CA, USA), E-cadherin (Abcam, Cambridge, MA, USA) and 53BP1 (Novus Biologicals, Littleton, CO, USA), with b-actin (Sigma, St. Louis, MO, USA) as the loading control. The membrane was then incubated with species-specific secondary horseradish peroxidase-conjugated antibodies (Sigma). Protein bands were revealed by using an ECL chemiluminescence kit (Pierce).

253

staining). The average value from the scores of two independent observers blinded to the clinical data was used as the final value. Immunoreactive scores (IRS = PP 9 SI) ranging from 3 to 6 were defined as IHC??, whereas IRS value \3 was defined as IHC 0 to ?. Cases with Nbs1 IHC?? were regarded as having increased expression of Nbs1. Cases with c-H2AX IHC level ?? were defined as having severe DNA DSBs. The Ki-67 score was calculated as the percentage of positively stained cells relative to the total number of cells. Ten high-power views were used for each slide, and 100 cells per view were counted for analysis. When there was discordance between the observers, a pathologic peer review was undertaken to determine a consensus score.

Statistical analysis The Wilcoxon signed rank sum test was used to compare the difference in mRNA levels in the tumor and adjacent non-tumor tissue. The chi-square test (for expected values [5) and Fisher’s exact test (for expected values B5) were used to determine molecular associations using SAS v9.2 software (SAS Institute, Inc., Cary, NC, USA). p \ 0.05 was considered statistically significant for all tests.

Immunohistochemistry (IHC) Sections (4 lm thick) were cut for IHC. After deparaffinization of the slides, endogenous peroxidase activity was blocked with 0.3 % H2O2 in methanol for 30 min. Antigen retrieval was performed in antigen unmasking solution (Vector H-3300) with microwaving for 15 min, keeping the solution boiling, followed by treatment with 5 % skimmed milk in phosphate-buffered saline (PBS)–0.1 % bovine serum albumin for at least 1 h at room temperature to block nonspecific staining. Immunohistochemical staining was performed using antibodies against Nbs1 (Abcam), DNA DSBs marker cH2AX (phosphorylated histone H2AX, Abcam) and proliferation marker Ki-67 (Dako, Ely, UK) at 4 °C overnight. Secondary antibody (Vector MP-7401) was used at 37 °C for 1 h, and visualization of antigen–antibody reactions was achieved with 3,30 -diaminobenzidine (Vector SK4100). Tissue structures were visualized by counterstaining with hematoxylin. For analysis of IHC staining of Nbs1 and c-H2AX, a modified scoring system was applied [23, 24]. The IHC reaction was scored by multiplying the percentage of positive tumor cells (PP: 1, \10 % positive tumor cells; 2, 10–49 %; 3, C50 % positive tumor cells) by their prevalent degree of staining (SI: 0, negative; 1, weak; 2, strong

Fig. 2 Correlation between NBS1 mRNA expression and IHC scoring of Nbs1 protein expression. Relative NBS1 mRNA expression levels were estimated by real-time PCR analysis in 22 pairs of HCC cases, 16 of which were available for IHC scoring of Nbs1 expression. A significantly higher level of mRNA was observed in tumor tissue than in adjacent non-tumor tissue in the group of HCC cases with a more than twofold increase in NBS1 mRNA expression. Asterisk six cases were available for IHC analysis. Error bars represent standard deviations

123

254

Hepatol Int (2014) 8:250–259

Fig. 3 Representative immunohistochemistry of Nbs1 protein expression. Left panel H&E staining showing tumor cells; right panel IHC staining of Nbs1. A HCC with Nbs1 expression level of IHC??, defined as increased Nbs1 expression, and B HCC with Nbs1 expression level of IHC?; C ICC with Nbs1 expression level of IHC?? and D ICC with Nbs1 expression level of IHC?. The scale bars represent 50 lm in each panel

Results NBS1 mRNA and protein expression increased in HCC cells compared with adjacent non-tumor cells HCC is the most common histological type of primary liver cancer. In the present study, 104 cases of primary liver cancer with different clinicopathological characteristics (Table 1), including 79 HCCs and 25 ICCs, were used for IHC analysis of Nbs1 expression. To compare Nbs1 expression by tumor tissues with that of adjacent nontumor tissues, 23 pairs of frozen tissue (22 cases of HCC, 1

123

case of ICC) and 56 pairs of paraffin sections (55 cases of HCC and 1 case of ICC) were analyzed. Real-time PCR indicated that 12 of the 22 frozen HCCs (54.6 %) had a more than twofold increase in NBS1 mRNA expression compared with adjacent non-tumor tissue (Fig. 1A). IHC demonstrated that 26 of 55 HCCs (47.3 %) had higher Nbs1 protein expression in tumors (IHC ??) than in adjacent tissues (IHC 0 to ?) (Fig. 1B). In 29 of 55 cases (52.7 %), expression levels of Nbs1 were the same between tumors and adjacent tissues. No adjacent nontumor tissues showed greater expression of Nbs1 than tumor tissues.

Hepatol Int (2014) 8:250–259

255

Western blot analysis of five pairs of representative tumor samples with increased Nbs1 expression (cases 327, 339, 343, 351 and 478; IHC??/[ twofold increase in mRNA) confirmed the presence of higher Nbs1 protein levels in tumors compared with adjacent non-tumor tissues (Fig. 1C). To validate the IHC findings for Nbs1 expression, 16 frozen HCC tissues with paired paraffin sections were used to evaluate the correlation between NBS1 mRNA and Nbs1 protein expression. Six cases with a more than twofold increase in mRNA in tumor tissues available for IHC analysis scored IHC?? for Nbs1 in tumor tissues, but IHC 0 to ? in adjacent non-tumor tissues; the other ten cases scored IHC 0 to ? in both tumor tissues and the corresponding adjacent non-tumor tissues, showing consistency between the findings of real-time PCR and IHC (Fig. 2). Western blot analysis, as described above, confirmed the correlation between NBS1 mRNA and protein expression levels detected by IHC (Fig. 1C). Increased Nbs1 expression associated with the degree of differentiation of HCC cells One hundred four cases of primary liver cancer, including 79 HCCs and 25 ICCs, were available for IHC scoring of Nbs1 expression as described above (Fig. 3). Increased Nbs1 expression was found in 80.0 % (20/25) of the ICCs and 48.1 % (38/79) of the HCCs (p = 0.00568). A greater frequency of increased Nbs1 expression was observed in HCCs at advanced stages ([stage 1) than in the early stage, but the difference was not statistically significant (p = 0.576; Table 2). However, a significantly higher frequency of increased Nbs1 expression was found in poorly differentiated HCC cells compared with well or moderately differentiated HCC cells (p = 0.0265; Table 2), indicating that the degree of differentiation of HCC was significantly associated with Nbs1 expression. Although not statistically significant, all investigated poorly differentiated ICCs showed increased Nbs1 expression (p = 0.289; Table 2). Table 2 Association between increased Nbs1 expression and clinical parameters of HCC or ICC

Clinical parameter

Increased Nbs1 expression associated with the proliferation and degree of DNA damage in HCC cells A specific marker for DNA DSBs, c-H2AX, was used to explore the association between increased Nbs1 expression and the degree of DSBs damage in HCC cells. The 79 cases of HCC in which Nbs1 expression had been identified were assessed for c-H2AX staining as described above (Fig. 4A, B). The frequency of c-H2AX IHC?? was 72.2 % (57/ 79). c-H2AX IHC?? was shown in 32 of 38 HCCs (84.2 %) with increased Nbs1 expression. A significantly higher frequency of HCCs with c-H2AX IHC?? was observed in HCCs with increased Nbs1 expression (p = 0.0213; Table 3), indicating that the severe DNA DSBs in HCC might be associated with increased Nbs1 expression. Cell proliferation was also analyzed in the 79 cases of HCC. The proliferation marker, Ki-67, was used as described above (Fig. 4C, D); C25, C50 and C75 % Ki67-positive HCC cells were used to compare the association of different levels of proliferation with Nbs1 expression. The proportion of cases with C25, C50 and C75 % Ki-67-positive HCC cells were 58.2 % (46/79), 30.4 % (24/79) and 8.9 % (7/79), respectively, in which increased Nbs1 expression was observed in 71.1 % (27/38), 47.4 % (18/38) and 18.4 % (7/38) of HCCs with increased Nbs1 expression. In all three groups, a significantly greater number of cases with Ki-67 positivity was observed among those with increased Nbs1 expression (Table 3), suggesting that increased Nbs1 expression was associated with proliferation. To validate the association of increased Nbs1 expression with proliferation, Western blot assays were performed to analyze the expression of the cell cycle-dependent proteins CCNB2 and PCNA, as well as E-cadherin, an epithelial cell marker [25], and 53BP1, a marker for DSBs [26], in five representative HCC cases including three poorly differentiated HCCs (case 327,343 and 351) with Nbs1 IHC level

HCC (n = 79)

ICC (n = 25)

N

N

Increased Nbs1 expression Case no. (%)

p value

0.576

Increased Nbs1 expression Case no. (%)

p value

Tumor stage Stage 1

40

18 (45.0)

[Stage 1

39

20 (51.3)

Positive

61

29 (48.3)

Negative

18

9 (50.0)

7

6 (85.7)

18

14 (77.8)

14

11 (78.6)

11

9 (81.8)

19

14 (73.7)

1.00

HBV infection

Bold value indicates statistical significance HCC hepatocellular carcinoma, ICC intrahepatic cholangiocarcinoma

Differentiation Well or moderate Poor

57

23 (41.2)

22

15 (68.2)

0.854

0.0265

6

1.00

0.289

6 (100.0)

123

256

Hepatol Int (2014) 8:250–259

Fig. 4 Representative immunohistochemistry of cH2AX and Ki-67. Left panel HE staining showing tumor cells right panel IHC staining of cH2AX and Ki-67. A c-H2AX staining level IHC??, defined as severe DNA DSBs; B HCC with c-H2AX level IHC?; C a representative case of HCC with 80 % Ki-67 positivity (Ki-67, 80 % ?); D a representative case of HCC with 20 % Ki-67 positivity (Ki-67, 20 % ?). The scale bars represent 50 lm in each panel

Table 3 Relationship of Nbs1 expression with the degree of proliferation and DNA DSBs in HCC Nbs1 expression

n

c-H2AX (IHC??)

Ki-67 (C25 %?)

Case no. (%)

p value

Case no. (%)

p value

Case no. (%)

p value

Case no (%)

p value

0.0213

27 (71.1)

0.0261

18 (47.4)

0.00157

7 (18.4)

0.00435

IHC??

38

32 (84.2)

IHC 0 to ?

41

25 (61.0)

19 (46.3)

Ki-67 (C50 %?)

6 (14.6)

Ki-67 (C75 %?)

0 (0)

Bold values indicate statistical significance c-H2AX phosphorylated histone H2AX

??/[twofold increase in mRNA expression and C50 % Ki67 positivity, one medium differentiated HCC (case 339) with Nbs1 IHC level ??/[twofold increase in mRNA expression and C25 % but\50 % Ki-67 positivity, and one well differentiated HCC (case 335) with Nbs1 IHC level ?/\ twofold

123

increase in mRNA expression and \25 % Ki-67 positivity. All five cases are c-H2AX IHC level ?? in tumor tissue. The results confirmed the correlation of increased Nbs1 expression with poor tumor differentiation and DSBs breakage in proliferated HCC cells (Fig. 5).

Hepatol Int (2014) 8:250–259

257

Fig. 5 Protein expression of Nbs1, PCNA, CCNB2, E-cadherin and 53BP1 in tumor and adjacent non-tumor tissue in representative cases of HCC. Western blot analysis of Nbs1, PCNA, CCNB2,E-cadherin, 53BP1 and b-actin in five representative cases: three poorly differentiated HCCs [case 327,343 and 351] with Nbs1 IHC level ??/[ twofold increase in mRNA expression and C50 % Ki-67

positivity, one medium differentiated HCC (case 339) with Nbs1 IHC level ??/[ twofold increase in mRNA expression and C25 % but \50 % Ki-67 positivity, and one well differentiated HCC (case 335) with Nbs1 IHC level 0 to ?/\twofold increase in mRNA expression and \25 % Ki-67 positivity]. All five cases are c-H2AX IHC level ?? in tumor tissue. b-actin was used as protein loading control

Discussion

H2AX to evaluate the extent of DSBs in the genome of HCC cells [30, 31]. We found a high frequency of severe DNA DSBs (c-H2AX??) in HCC cells and the correlation between increased Nbs1 expression and severe DNA DSBs (p = 0.0213). In addition, a mouse model and in vitro study have shown Nbs1 to be expressed in highly proliferating tissues [32, 33]. Similarly, in the present study, the results from an ICC case showed high Nbs1 expression in both tumor and adjacent non-tumor tissue with hyperplastic bile duct (Supplementary Fig. 1). To illustrate whether increased Nbs1 expression is associated with proliferation, we used Ki-67 to evaluate the proliferation of HCC cells [34, 35]. The results showed significant correlation between increased Nbs1 expression with cell proliferation and were further confirmed by increased expression of cell cycle-independent protein CCNB2 and PCNA in tumor tissues with increased Nbs1 expression. As a crucial DNA repair-associated gene, reduced Nbs1 expression could promote tumor development through less efficient DSBs repair in combination with impaired checkpoint signaling and an apoptotic defect [18–20]. The underlying mechanism of increased Nbs1 expression in certain types of tumor remains unclear. In a recent study, Nbs1 expression was proposed to be activated directly by c-Myc oncoprotein, and overexpression of Nbs1 is an oncogenic event that induces transformation through the activation of the phosphatidylinositol 3-kinase/Akt/mTOR pathway or induces the epithelial–mesenchymal transition (EMT) [36]. However, our results notably showed significant correlation among Ki-67 and c-H2AX, and increased Nbs1 expression in HCC cases. The degree of DNA damage has been demonstrated to be more obvious in proliferating than quiescent

Many genetic and epigenetic changes have been identified in precancerous hepatic lesions and in HCC, including chromosomal amplification, mutations, loss of heterozygosity and global DNA hypermethylation [2, 27]. The Wnt/bcatenin pathway is commonly disrupted in HCC, usually as a result of mutations in CTNNB1 or AXIN1, or epigenetic silencing of CDH1 [27]. The p53 and Rb1 pathways are often disturbed in HCC, p53 particularly by exposure to aflatoxin [28]. The PI3K/Akt/mTOR pathway is also commonly disrupted, sometimes because of abnormal inactivation of tyrosine kinase receptors or as a result of constitutive activation of PI3K following loss of function of the tumor-suppressor gene PTEN [29]. Derangements of other signal transduction pathways, such as the MAPK pathway and the TGF-b pathway, also play roles in hepatocarcinogenesis [28]. Therefore, HCC is characterized by remarkable molecular heterogeneity. In the present study, we reported for the first time that altered expression of NBS1, a DNA repair-associated gene, may play a role in the pathogenesis of primary liver cancer. The facts that both reduced and increased levels of Nbs1 were identified in different types of tumor reflect the diverse functions of the protein on tumorigenesis [18]. In the present study, increased levels of Nbs1 were identified in HCCs and ICCs, especially in poorly differential tumor cells. Previous studies have demonstrated that multiple risk factors can cause DNA DSBs in hepatocytes, and accumulation of damaged DNA greatly increases the risk of HCC [3].To illustrate whether increased Nbs1 expression is associated with the degree of DNA damage, we used c-

123

258

cells [37]. Thus, our study provided another possibility that increased Nbs1 expression in HCC might result from the activated DNA damage response in proliferating HCC cells, which could be explained as a barrier function in maintaining genomic stability against HCC progression, consistent with a previous report that overexpression of Nbs1 in tumors could be a caretaker and has a barrier function to against tumor progression [38]. Similar to those reported in HNSCC and NO-HNSCC, in which increased Nbs1 expression was present in 45 and 53.5 % of advanced tumors [20, 21], the present study showed a higher frequency (51.3 %) of increased Nbs1 expression in advanced HCC than in early HCC, but this was not statistically significant, most likely because of the inadequate number of cases analyzed. However, a significantly higher frequency of increased Nbs1 expression in poorly differentiated HCC compared with well or moderately differentiated HCC suggested that the increased Nbs1 expression correlates with the degree of malignancy of HCC cells. Our findings provided valuable information concerning the identification and characterization of a novel molecular marker that has potential to be applied in the diagnosis, prognosis and management of patients with HCC. In summary, this study provided the first evidence of increased Nbs1 expression in HCC and ICC, which might result from the activated DNA damage response in proliferating tumor cells and would be helpful in increasing the understanding of the molecular pathogenesis of primary liver cancer. Acknowledgements The authors would like to thank Dr. Zheng-Yu Wei (Division of Transplantation, Department of Surgery, Thomas Jefferson University, Philadelphia, PA, USA) for critical manuscript reading and helpful suggestions. This work was supported by grants from the National Natural Science Foundation of China (81071973) and the Beijing Natural Science Foundation (7132058), and the Wang Bao-En Liver Fibrosis Foundation (20100013). Dr Wei-Min Tong was supported in part by National Natural Science Foundation of China (30970602) and 111 project. Compliance with ethical requirements and Conflict of interest All patients gave consent to the use of their clinical materials for research purpose; the study protocol was approved by the Clinical Research Ethics Committee of Beijing Friendship Hospital. The authors declare they have no conflict of interests.

References 1. Theise ND, Curado MP, Franceschi S, et al. Hepatocellular carcinoma. In Bosman FT, Carneiro F, Hruban RH, et al. editors. Lyon: WHO Classification of Tumors of the Digestive System; 2010. pp. 205–216 2. Thorgeirsson SS, Grisham TW. Molecular pathogenesis of human hepatocellular carcinoma. Nat Genet 2002;31:339–346

123

Hepatol Int (2014) 8:250–259 3. Zhu DQ, Huang ZY. DNA damage and Iiver cancer. World Chin J Digestol 2007;15:1775–1780 4. D’Amours D, Jackson SP. The MRE11 complex: at the crossroads of DNA repair and checkpoint signaling. Nat Rev Mol Cell Biol 2002;3:317–327 5. Stracker TH, Theunissen JW, Morales M, Petrini JH. The MRE11 complex and the metabolism of chromosome breaks: the importance of communicating and holding things together. DNA Repair 2004;3:845–854 6. Zhang Y, Zhou JQ, Lim CU. The role of NBS1 in DNA double strand break repair, telomere stability, and cell cycle checkpoint control. Cell Res 2006;16:45–54 7. Varon R, Seemanova E, Chrzanowska K, Hnateyko O, Piekutowska-Abramczuk D, Krajewska-Walasek M, Sykut-Cegielska J, Sperling K, Reis A. Clinical ascertainment of Nijmegen Breakage Syndrome (NBS) and prevalence of the major mutation, 657del5, in three Slav populations. Eur J Hum Genet 2000;8:900–902 8. Lee JH, Paull TT. ATM activation by DNA double-strand breaks through the Mre11-Rad50-Nbs1 complex. Science 2005;308: 551–554 9. Jazayeri A, Balestrini A, Garner E, Haber JE, Costanzo V. Mre11-Rad50-Nbs1-dependent processing of DNA breaks generates oligonucleotides that stimulate ATM activity. EMBO J 2008;27:1953–1962 10. Stracker TH, Petrini JH. The MRE11 complex: starting from the ends. Nat Rev Mol Cell Biol 2011;12:90–103 11. Lee JH, Lim DS. Dual role of NBS1 in the ataxia telangiectasia mutated-dependent DNA damage response. FEBS J 2006;273: 1630–1636 12. Bogdanova N, Feshchenko S, Schurmann P, Waltes R, Wieland B, Hillemanns P, Rogov YI, Dammann O, Bremer M, Karstens JH, Sohn C, Varon R, Do¨rk T. Nijmegen Breakage Syndrome mutations and risk of breast cancer. Int J Cancer 2008;122: 802–806 13. Nowak J, Mosor M, Ziolkowska I, Wierzbickab M, PernakSchwarza M, Przyborska M, Roznowski K, Pławski A, Słomski R, Januszkiewicz D. Heterozygous carriers of the I171V mutation of the NBS1 gene have a significantly increased risk of solid malignant tumors. Eur J Cancer 2008;44:627–630 14. Huang J, Grotzer MA, Watanabe T, Hewer E, Pietsch T, Rutkowski S. Hiroko Ohgaki. Mutations in the Nijmegen Breakage Syndrome gene in medulloblastomas. Clin Cancer Res 2008;14: 4053–4058 15. Watanabe T, Nobusawa S, Lu SQ, Huang J, Mittelbronn M, Ohgaki H. Mutational inactivation of the Nijmegen Breakage Syndrome gene (NBS1) in glioblastomas is associated with multiple TP53 mutations. J Neuropath Exp Neurol 2009;68: 210–5 16. Varon R, Reis A, Henze G, von Einsiedel HG, Sperling K, Seeger K. Mutations in the Nijmegen Breakage Syndrome gene (NBS1) in childhood acute lymphoblastic leukemia (ALL). Cancer Res 2001;61:3570–572 17. Chrzanowska KH, Piekutowska-Abramczuk D, Popowska E, Gladkowska-Dura M, Maldyk J, Syczewska M, Krajewska-Walasek M, Goryluk-Kozakiewicz B, Bubała H, Gadomski A, Gaworczyk A, Kazanowska B. Carrier frequency of mutation 657del5 in the NBS1 gene in a population of Polish pediatric patients with sporadic lymphoid malignancies. Int J Cancer 2006;118:1269–1274 18. Dzikiewicz-Krawczyk A. The importance of making ends meet: mutations in genes and altered expression of proteins of the MRN complex and cancer. Mutat Res 2008;659:262–273 19. Kruger L, Demuth I, Neitzel H, Varon R, Sperling K, Chrzanowska KH, Seemanova E, Digweed M. Cancer incidence in

Hepatol Int (2014) 8:250–259

20.

21.

22.

23.

24.

25.

26.

27.

Nijmegen Breakage Syndrome is modulated by the amount of a variant NBS protein. Carcinogenesis 2007;28:107–111 Yang MH, Chiang WC, Chou TY, Chang SY, Chen PM, Teng SC, Wu KJ. Increased NBS1 expression is a marker of aggressive head and neck cancer and overexpression of NBS1 contributes to transformation. Clin Cancer Res 2006;12:507–515 Hsu DS, Chang SY, Liu CJ, Tzeng CH, Wu KJ, Kao JY, Yang MH. Identification of increased NBS1 expression as a prognostic marker of squamous cell carcinoma of the oral cavity. Cancer Sci 2010;101:1029–1037 Dumon-Jones V, Frappart PO, Tong WM, Sajithlal G, Hulla W, Schmid G, Wang ZQ. Mice heterozygous for NBN (the murine homologue of NBS1) developed a wide variety of tumors affecting the liver, mammary gland, prostate, and lung, in addition to lymphomas. Cancer Res 2003;63:7263–7269 Scharl A, Vierbuchen M, Conradt B, Moll W, Wu¨rz H, Bolte A. Immunohistochemical detection of progesterone receptor in formalin-fixed and paraffin-embedded breast cancer tissue using a monoclonal antibody. Arch Gynecol Obstet 1990;247:63–71 Qian CN, Furge KA, Knol J, Huang D, Chen JD, Dykema KJ, Kort EJ, Massie A, Khoo SK, Beldt KV, Resau JH, Anema J, Kahnoski RJ, Morreau H, Camparo P, Comperat E, Sibony M, Denoux Y, Molinie V, Vieillefond A, Eng C, Williams BO, Teh BT. Activation of the PI3K/AKT pathway induces urothelial carcinoma of the renal pelvis: identification in human tumors and confirmation in animal models. Cancer Res 2009;69:8256–8264 Liu D, Huang C, Kameyama K, Hayashi E, Yamauchi A, Kobayashi S, Yokomise H. E-cadherin expression associated with differentiation and prognosis in patients with non-small cell lung cancer. Ann Thorac Surg 2001;71:949–954 Ward IM, Minn K, Jorda KG, Chen J. Accumulation of checkpoint protein 53BP1 at DNA breaks involves its binding to phosphorylated histone H2AX. J Biol Chem 2003;278:19579–19582 Mı´nguez B, Tovar V, Chiang D, Villanueva A, Llovet J. Pathogenesis of hepatocellular carcinoma and molecular therapies. Curr Opin Gastroen 2009;25:186–194

259 28. Aravalli RN, Steer CJ, Cressman EN. Molecular mechanism of hepatocellular carcinoma. Hepatology 2008;48:2047–2063 29. Villanueva RR, Chiang DY, Newell P, Peix J, Thung S, Alsinet C. Pivotal role of mTOR signaling in hepatocellular carcinoma. Gastroenterology 2008;135:1972–1983 30. Kuo LJ, Yang LX. c-H2AX—a novel biomarker for DNA Double-strand breaks. In Vivo 2008;22:305–310 31. Huang X, Darzynkiewicz Z. Cytometric assessment of histone H2AX phosphorylation: a reporter of DNA damage. Methods Mol Biol 2006;314:73–80 32. Wilda M, Demuth I, Concannon P, Sperling K, Hameister H. Expression pattern of the Nijmegen Breakage Syndrome gene, NBS1, during murine development. Hum Mol Genet 2000;9: 1739–1744 33. Chiang YC, Teng SC, Su YN, Hsieh FC, Wu KJ. c-Myc directly regulates the transcription of the NBS1 gene involved in DNA double-strand break repair. J Biol Chem 2003;278:19286–19291 34. Burcombe R, Wilson GD, Dowsett M, Khan I, Richman PI, Daley F. Evaluation of Ki-67 proliferation and apoptotic index before, during and after neoadjuvant chemotherapy for primary breast cancer. Breast Cancer Res 2006;8:1–10 35. Yerushalmi R, Woods R, Ravdin PM, Hayes MM, Gelmon KA. Ki67 in breast cancer: prognostic and predictive potential. Lancet Oncol 2010;11:174–183 36. Chen YC, Su YN, Chou PC, Chiang WC, Chang MC, Wang LS, Teng SC, Wu KJ. Overexpression of NBS1 contributes to transformation through the activation of phosphatidylinositol 3-kinase/Akt. J Biol Chem 2005;280:32505–32511 37. Zhou Y, Shi JT, Wu JH, Tao DD, Hu JB, Gong JP. The effect of cell proliferation on cell sensitivity to the DNA damage. Chin J Exp Surg 2008;25:1660–1662 38. Jackson SP, Bartek J. The DNA damage response in human biology and disease. Nature 2009;461:1071–1078

123