Trop Anim Health Prod DOI 10.1007/s11250-015-0767-x

REGULAR ARTICLES

Development of loop-mediated isothermal amplification test for the diagnosis of contagious agalactia in goats Valsala Rekha & Rajneesh Rana & Prasad Thomas & Konasagara Nagaleekar Viswas & Vijendra Pal Singh & Rajesh Kumar Agarwal & Thachappully Remesh Arun & Kumaragurubaran Karthik & Inbaraj Sophia

Received: 21 July 2014 / Accepted: 12 January 2015 # Springer Science+Business Media Dordrecht 2015

Abstract Contagious agalactia is a highly infectious disease affecting sheep and goats, mainly caused by Mycoplasma agalactiae. Although various tests are available for diagnosis of contagious agalactia, none of them is credited with the capacity to provide rapid and cost-effective diagnosis. This article reports the development of loop-mediated isothermal amplification (LAMP) test targeting the p40 gene of M. agalactiae, for the diagnosis of classical contagious agalactia. Optimum amplification was obtained at 58 °C in 70 min. The developed test was found to be 100-fold more sensitive than PCR and detected up to 20-fg level of DNA. The test was also superior to conventional PCR in detecting from artificially contaminated milk, i.e. 104-fold more sensitive. The developed LAMP test could detect up to 10 cfu/ml of artificially contaminated milk, indicating its potential for being developed as a field test for rapid and sensitive diagnosis. Keywords Contagious agalactia . Mycoplasma agalactiae . p40 gene . LAMP . PCR . Diagnostic test

Introduction Contagious agalactia is an important mycoplasmal disease affecting sheep and goat which has been reported worldwide. Although various species of mycoplasma have been found to be associated with the disease, Mycoplasma agalactiae is

V. Rekha (*) : R. Rana : P. Thomas : K. N. Viswas : V. P. Singh : R. K. Agarwal : T. R. Arun : K. Karthik : I. Sophia Division of Bacteriology & Mycology, Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar Pradesh 243122, India e-mail: [email protected]

considered as the classical etiological agent. The disease is manifested as mastitis, arthritis and keratoconjunctivitis. The disease results in significant reduction in milk yield and/or cessation of milk production (Corrales et al. 2007). This underlines the importance of disease diagnosis with respect to rural economy/goat cheese industries dependent on milk production. Considering the widespread distribution and economic impact, contagious agalactia has been included by OIE under the list of notifiable diseases (Kumar et al. 2014a; OIE 2013). Traditionally, the diagnosis of contagious agalactia was based on isolation and biochemical characterisation. But, the time involved makes it unsuitable for field diagnosis, and many a times the disease goes undiagnosed or overlooked. Serological tests used for diagnosis include indirect haemagglutination (IHA) test, complement fixation test (CFT), enzyme-linked immunosorbent assay (ELISA) and lateral flow assay (Kumar et al. 2014a; Arun et al. 2014). Although various serological tests are available for diagnosis of contagious agalactia, these will not be an effective tool for detection of carrier state as there will not be serological response to the organism in carrier state (Gómez-Martín et al. 2013; Hegde et al. 2014). The likelihood of cross-reactivity with other species of Mycoplasma (for example, Mycoplasma bovis) precludes the use of serological tests for routine diagnosis. Various nucleic acid amplification based molecular detection methods for diagnosis have been developed over time like PCR (Tola et al. 1997; Greco et al. 2001; Peyraud et al. 2003), PCR-DGGE analysis (McAuliffe et al. 2003), PCRRFLP (Foddai et al. 2005), real-time PCR (Becker et al. 2012) and immunomagnetic capture-PCR (Sanna et al. 2014). The requirement of a thermocycler makes the application of these PCR techniques difficult, as well as the cost involved at field level.

Trop Anim Health Prod

Loop-mediated isothermal amplification (LAMP) test is a novel nucleic acid amplification technique, developed by Notomi et al. in 2000. This is based on the principle of strand displacement activity by a specialised polymerase enzyme, i.e. Bst polymerase. It involves the use of a minimum four sets of primers, i.e. two inner and two outer primers. Amplification is carried out under isothermal conditions with optimal activity at temperatures ranging from 50 to 65 °C, thus making it independent of expensive thermocycler. Reduction of reaction time as well as increase in specificity can be achieved by incorporation of two extra primers, namely loop primers (Nagamine et al. 2002). Result of amplification reaction can be interpreted visually by the addition of fluorescent intercalating dye SYBR Green I to the tubes post-amplification (Parida et al. 2008), making it more suitable for field level diagnosis. Many reports are available regarding the use of LAMP test for bacterial disease diagnosis—Renibacterium salmoninarum (Saleh et al. 2008), Escherichia coli (Hill et al. 2008), Brucella (Lin et al. 2011), Listeria monocytogenes (Wang et al. 2011), Actinobacillus pleuropneumoniae (Ji et al. 2012), Bacillus anthracis spores (Dugan et al. 2012), CBPP (Mair et al. 2013) and Coxiella burnetti (Chen and Ching 2014). As per the current literature available, no LAMP test is available for the detection of M. agalactiae. Taking these facts into consideration, the current study was pursued with the objective of developing LAMP test for the detection of M. agalactiae, to reduce the time involved in diagnosis and to minimise the cost involvement in terms of independency over thermocycler.

Materials and methods Designing of LAMP primers and optimisation of reaction conditions LAMP primers specific for M. agalactiae were designed using Primer Explorer version 4 software (Primer Explorer V4, Eiken Chemical Co., Ltd.). M. agalactiae and M. bovis have a high degree of homology in their gene sequences. The gene sequences of p40 of M. agalactiae (GenBank Accession AJ344229.1) and pseudo p40 of M. bovis (Thomas et al. 2004) are available on NCBI. The primers were designed based on the region of M. agalactiae p40 gene showing dissimilarity with that of M. bovis. During primer designing, the primer lengths were increased to compensate the low GC content of the target primers. The primers were procured from Eurofins MWG Operon, Bangalore, and Bioserve Biotechnologies (India) Pvt. Ltd., Hyderabad. The primer sequences are given in Table 1. Genomic DNA was extracted according to the method of Sambrook and Russel (2001). The designed LAMP was optimised by trying with different temperatures and different concentrations of each reaction components (dNTP, MgSO4, betaine, primer concentration, etc.). Extraction of

Table 1 Loop-mediated isothermal amplification (LAMP) primers designed for detection of M. agalactiae Primer

Sequence (5′-3′)

Length (bp)

F3 Forward outer primer B3 Backward outer primer FIP Forward inner primer

GGTTTATTAACTGCGTCATCA

21

CAACAGTTGCATTCGTCTT

19

ACCTTATCACCATTATCTTGT GGATCAGTGCCTTTATTAG CTGCTA AGCATTAGGTGAAGTTGTCA AAAATATTGAGCTTGCTTC AGGAATT GTGAATTTTCGTTCTTATCAT CAC ACAAATCTAGGTGAAATAGT ATTACC

46

BIP Backward Inner Primer FLP Forward Loop Primer BLP Backward Loop Primer

46

24 26

DNA, amplification and post-amplification analysis were carried out in separate rooms. Separate sets of pipettes and filter tips were used for each of these steps to avoid chances of contamination. Besides, no template control was run along with all reactions to identify false positive reaction due to contamination. Analysis and confirmation of LAMP product LAMP product was visualised by the addition of 1 μl of 1:10 diluted SYBR Green I dye (Sigma-Aldrich) to the tubes postamplification. The change in colour was observed with the naked eye as well as using UV torch. The product was also confirmed by running 5 μl of the product in 2 % agarose gel in 1× TAE. After optimisation of reaction conditions, restriction digestion of the purified LAMP product was carried out with the enzyme SspI (Fermentas) at 37 °C for 4 h, in order to confirm the specificity of the developed LAMP test. The restriction digested product was run along with undigested LAMP product in 2 % agarose gel and stained with 0.5 μg/ml ethidium bromide. The gel was visualised under UV transilluminator. Sensitivity as well as specificity of the developed LAMP was determined. Comparison of sensitivity of LAMP with that of PCR The concentration of template DNA was determined using nanodrop, which was found to be 50 ng/μl. In order to find out the sensitivity, tenfold serial dilutions of the template DNAwere made in nuclease-free water. Then, 4 μl of template DNA from each dilution was added in each 25-μl reaction, in both PCR and LAMP. The final template DNA concentrations in the tubes 1–10 were 200 ng, 20 ng, 2 ng, 200 pg, 20 pg, 2 pg, 200 fg, 20 fg, 2 fg and 0.2 fg respectively. Sensitivity of LAMP was compared with that of conventional PCR (Tola et al. 1997).

Trop Anim Health Prod

BLP, 8 U Bst polymerase (NEB) and 4 μl template. These reaction conditions were followed in sensitivity assay.

Determination of specificity of LAMP To assess the specificity of LAMP, the reaction was carried out using templates from related organisms, listed in Table 2. For further confirmation, amplification with some more Indian isolates of M. agalactiae was also tried. Assessment of suitability of developed LAMP for detection in artificially contaminated milk samples For assessing the suitability of LAMP for detection from milk samples, artificial contamination of milk was done using serial dilutions of culture of M. agalactiae standard UK 10123 (1071 cfu). The DNA was extracted from milk using Qiagen DNeasy Blood & Tissue kit. LAMP as well as PCR was done with the extracted DNA.

Confirmation of LAMP product Immediately after the reaction, 1 μl of 1000× SYBR Green I was added to the tubes. In case of positive reaction, colour changed from orange to green, which can be very well detected with naked eyes (Fig. 1a). Also, the tubes were visualised under UV torch (Fig. 1b). Strong green fluorescence was emitted in positive cases. Typical ladder-like pattern was produced in LAMP-positive reactions on electrophoresis in 2 % agarose gel (Fig. 1c). Restriction digestion using the enzyme SspI resulted in three different bands of sizes 168, 228, and 288 bp respectively, as expected confirming the specificity of the developed test. Sensitivity of LAMP and PCR On comparing the sensitivity of PCR with that of LAMP, PCR was able to detect up to 2-pg level (Fig. 2a), while LAMP could detect up to 20-fg level on agarose gel electrophoresis (Fig. 2b), i.e. 100-fold more sensitive.

Results Optimisation of reaction conditions Optimum amplification was obtained at temperature of 58 °C. The optimal reaction time was found to be 70 min. The 25-μl reaction mixture for optimal amplification contained 2.5 μl 10× Thermopol buffer (NEB), 0.8 mM dNTP (Fermentas), 4 mM MgSO4 (NEB), 0.6 M betaine (Sigma), 0.2 μM F3, 0.2 μM B3, 1.6 μM FIP, 1.6 μM BIP, 0.8 μM FLP, 0.8 μM

Table 2

Various bacteria used for testing specificity of LAMP

Sl no.

Bacteria

Result with LAMP

1

Mycoplasma agalactiae UK10123 200 RPNS 216 RPNS VP20 L15/02 5/11 NS 5/11 milk

+

M. bovis M. mycoides subsp. capri M. arginini M. capricolum subsp. capricolum M. leachii Clostridium chauvoei Brucella abortus Staphylococcus aureus Escherichia coli

− − − − − − − − −

2 3 4 5 6 7 8 9 10

LAMP loop-mediated isothermal amplification

+ + + + +

Specificity of LAMP assay The developed LAMP was found to be highly specific, since amplification was shown only in case of M. agalactiae, while reactions were carried out using templates from related organisms. Besides, positive reaction was obtained with all of the PCR-confirmed Indian isolates of M. agalactiae (Table 2). Sensitivity of LAMP and PCR for detection of M. agalactiae from artificially contaminated milk On carrying out the reactions with extracted DNA from artificially contaminated milk, PCR was able to detect up to the level of 105 cfu (Fig. 3a), while LAMP could detect up to 10 cfu (Fig. 3b). LAMP was found to be far more sensitive in detecting M. agalactiae from artificially contaminated milk samples. Similar detection limits were observed for LAMP on agarose gel electrophoresis as well as visual detection after addition of SYBR Green I post-amplification.

Discussion M. agalactiae is the classical etiological agent associated with contagious agalactia, an important mycoplasmal disease of sheep and goats. Recent literature shows outbreaks and serological prevalence of disease in many countries—Spain (Ariza-Miguel et al. 2012), Greece (Filioussis et al. 2011),

Trop Anim Health Prod

a

b

ƒFig. 1

Analysis of LAMP product (a) after addition of SYBR Green I, under day light (b) after addition of SYBR Green I, under UV light (c) agarose gel electrophoresis in 2 % agarose gel

UK (WAHIS 2014), Iran (Khezri et al. 2014) and India (Kumar et al. 2009; Kumar et al. 2014b)—and most of the time, it is associated with the introduction of carrier animals. Healthy animals can act as carriers of infections, without exhibiting clinical manifestations of the disease. There are reports of identification of M. agalactiae from ear swab, milk and semen of such healthy carriers (De la Fe et al. 2010; Gómez-Martín et al. 2012; Alves et al. 2013). These animals pose potential risk of spreading infection in the herd, which in turn will affect the productivity in terms of milk production and fertility. Therefore, it is important to identify carrier animals in order to contain infection. Serological tests are inadequate for identifying carriers because of the serological unresponsiveness and chronic nature.

a

c

b

Fig. 2 Sensitivity test for loop-mediated isothermal amplification (LAMP) and PCR using 10-fold serial dilutions of DNA templates. a Result of agarose gel electrophoresis of PCR products; b result of agarose gel electrophoresis of LAMP products. Lane 1, 200 ng; lane 2, 20 ng; lane 3, 2 ng; lane 4, 200 pg; lane 5, 20 pg; lane 6, 2 pg; lane 7, 200 fg; lane 8, 20 fg; lane 9, 2 fg; lane 10, 0.2 fg; M 100-bp marker

Trop Anim Health Prod Fig. 3 Sensitivity of PCR and LAMP using milk artificially contaminated with different cfu of M. agalactiae. a Result of agarose gel electrophoresis of PCR products; b result of agarose gel electrophoresis of LAMP products. Lane 1, 107 cfu; lane 2, 106 cfu; lane 3, 105 cfu; lane 4, 104 cfu; lane 5, 103 cfu; lane 6, 102 cfu; lane 7, 10 cfu; lane 8, 1 cfu; M, 100-bp marker

a

b

There was great revolution in the field of disease diagnosis with the invention of polymerase chain reaction. PCR was developed as a diagnostic tool for detection of a variety of microorganisms. But, the need for a thermocycler restricted its use to laboratories with good facility. In 2000, a novel amplification method—loop-mediated isothermal amplification (LAMP)—was developed by Notomi et al. This does not need a thermocycler, as the amplification is carried out under isothermal conditions. Hence, it can be efficiently used for field-level diagnosis in low resource setting areas (Nirju 2012). LAMP assay has been developed for the diagnosis of a number of diseases. In this study, we developed LAMP test for the detection of M. agalactiae based on the p40 gene sequence. The choice of gene for the designing of primers was based on the report by Thomas et al. in 2004 that M. bovis, which is closely related to M. agalactiae, was having pseudo p40* gene with some

deletions in the sequence. The developed assay could give result in 70-min time at 58 °C, thus reducing the time for diagnosis. The result could be detected visually by the addition of SYBR Green I dye post-amplification, and this does not require agarose gel electrophoresis. Visual detection results were consistently matching with those of agarose gel electrophoresis, which can reduce the time needed for result analysis. For validation of the test specificity, LAMP product was confirmed by restriction digestion using SspI. LAMP is considered widely as a more sensitive technique in comparison to PCR. In order to determine the sensitivity of the developed LAMP and PCR, serial dilutions of template were made in nuclease-free water, and the detection limit was found out. PCR was found to be sensitive up to 2-pg level. At the same time, the sensitivity of LAMP was 100-fold more, i.e. up to 200 fg. This result was comparable with the reports of LAMP for Campylobacter foetus (Yamazaki et al. 2009),

Trop Anim Health Prod

orf (Tsai et al. 2009) and Mycoplasma wenyonii (Song et al. 2012). The developed LAMP was also assessed for specificity using templates from different related bacterial species. Amplification was given only by M. agalactiae, suggesting it to be specific for M. agalactiae. No cross-reaction was shown with closely related M. bovis. This test could be very well used to differentiate between M. agalactiae and M. bovis, which are cross-reactive in most of the serological tests due to high degree of homology. The developed assay had shown promising ability to detect Indian isolates of M. agalactiae other than the standard strain. It amplified all the PCR-confirmed isolates, indicating its specificity. LAMP is comparatively more tolerant to the inhibitory effect of most biological substances that affect PCR amplification (Kaneko et al. 2007). There are many studies regarding the use of LAMP as a screening method for biological samples. To evaluate the suitability of the developed LAMP for detection from milk samples, artificial contamination of milk samples was done with known cfu of M. agalactiae. PCR was able to detect up to 105 cfu, while LAMP showed amplification of up to 10 cfu level, i.e. 104 times more sensitive. It was consistent with the report of Wang et al. in 2009 for the detection of Shigella spp. in milk. The LAMP assay for E. coli O157 was reported to give artificially contaminated raw milk sample detection limit level of 410 cfu/ml, while the detection level of conventional PCR was 4.1×104 cfu/ml, i.e. 100 times sensitive (Wang et al. 2008). In case of L. monocytogenes detection by LAMP and PCR using different dilutions of artificially contaminated raw milk, LAMP was showing 103fold more sensitivity than conventional PCR (Wang et al. 2011). In short, the LAMP assay was found to be more suitable for detection from biological samples. In this study, the suitability for detection from artificially contaminated milk was conducted. It has to be extended to the field sample studies to further validate the results. Also, future studies are needed to make it more suited for field level diagnosis, by making in-tube detection possible. Acknowledgments The authors sincerely acknowledge the financial support to this work, extended by the Director, Joint Director (Academic) and Joint Director (Research), Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar Pradesh, India. Conflicts of interest The authors declare that they have no conflict of interest. This research work was conducted as part of M.V.Sc degree programme with the funding from Indian Veterinary Research Institute, Izatnagar.

References Alves, B.H.L.S., Silva, J. G., Mota, A.R., Campos, A.C., Júnior, J.W.P., Santos, S.B., Mota, R.A., 2013. Mycoplasma agalactiae in semen

and milk of goat from Pernambuco State, Brazil, Pesquisa Veterinária Brasileira, 33, 1309-1312 Ariza-Miguel, J., Rodríguez-Lázaro, D., Hernández, M., 2012. A survey of Mycoplasma agalactiae in dairy sheep farms in Spain, BMC Veterinary Research, 8, 171-176 Arun, T.R., Rana, R., Singh, P., Choudhari, P., Singh, V.P., Thomas, P., Rekha, V., Nehra, K., Usharani, J., Dhama, K., 2014. Development of a Gold Nanoparticle Based Lateral Flow Assay for Rapid Diagnosis of Contagious Agalactia in Goats, Asian Journal of Animal and Veterinary Advances, 9, 405-413 Becker, C.A.M., Ramos, F., Sellal, E., Moine, S., Poumarat, F., Tardy, F., 2012. Development of a multiplex real-time PCR for contagious agalactiae diagnosis in small ruminants, Journal of Microbiological Methods, 90, 73-79 Chen, H.W., Ching, W.M., 2014. Development of loop-mediated isothermal amplification assay for rapid and easy detection of Coxiella burnetti, Journal of Microbiological Methods, 107, 176-181 Corrales, J.C., Esnal, A., De la Fe, C., Sanchez, A., Assuncao, P., Poveda, J.B., Contreras, A., 2007. Contagious agalactiae in small ruminants, Small Ruminant Research, 68, 154-166 De la Fe, C., Gómez-Martín, A., Amores, J., Corrales, J.C., Sánchez, A., Poveda, J.B., Contreras, A., 2010. Latent infection of male goats with Mycoplasma agalactiae and Mycoplasma mycoides subspecies capri at an artificial insemination centre, The Veterinary Journal, 186, 113–115 Dugan, L., Bearinger, J., Hinckley, A., Strout, C., Souza, B., 2012. Detection of Bacillus anthracis from spores and cells by loopmediated isothermal amplification without sample preparation, Journal of Microbiological Methods, 90, 280-284 Filioussis, G., Giadinis, N.D., Petridou, E.J., Karavanis, E., Papageorgiou, K., Karatzias, H., 2011. Congenital polyarthritis in goat kids attributed to Mycoplasma agalactiae, Veterinary Record, 169, 364 Foddai, A., Idini, G., Fusco, M., Rosa, N., De la Fe, C., Zinellu, S., Corona, L., Tola, S., 2005. Rapid differential diagnosis of Mycoplasma agalactiae and Mycoplasma bovis based on a multiplex-PCR and a PCR-RFLP, Molecular and Cellular Probes, 19, 207-212 Gómez-Martín, A., De la Fe, C., Amores, J., Sanchez, A., Contreras, A., Paterna, A., Buendia, A.J., Corrales, J.C., 2012. Anatomic location of Mycoplasma mycoides subsp. capri and Mycoplasma agalactiae in naturally infected goat male auricular carriers, Veterinary Microbiology, 157, 355–362 Gómez-Martín, A., Amores, J., Paterna, A., De la Fe, C., 2013. Contagious agalactia due to Mycoplasma spp. in small dairy ruminants: Epidemiology and prospects for diagnosis and control, The Veterinary Journal, 198, 48–56 Greco, G., Corrente, M., Martella, V., Pratelli, A., Buonavoglia, D., 2001. A multiplex-PCR for the diagnosis of contagious agalactia of sheep and goats, Molecular and Cellular Probes, 15, 21–25 Hegde, S., Hegde, S., Spergser, J., Brunthaler, R., Rosengarter, R., Chopra-Dewasthaly, R., 2014. In vitro and in vivo cell invasion and systemic spreading of Mycoplasma agalactiae in the sheep infection model, International Journal of Medical Microbiology, 304, 1024-1031 Hill, J., Beriwal, S., Chandra, I., Paul, V.K., Kapil, A., Singh, T., Wadowsky, R.M., Singh, V., Goyal, A., Jahnukainen, T., Johnson, J.R., Tarr, P.I. and Vats, A., 2008. Loop- Mediated Isothermal Amplification Assay for Rapid Detection of Common Strains of Escherichia coli, Journal of Clinical Microbiology, 46, 2800–2804 Ji, H., Li, H., Zhu, L., Zhang, H., Wang, Y., Zuo, Z., Guo, W., Xu, Z., 2012. Development and evaluation of a loop-mediated isothermal amplification (LAMP) assay for rapid detection of Actinobacillus pleuropneumoniae based the dsbE-like gene1, Pesquisa Veterinária Brasileira, 32, 757-760

Trop Anim Health Prod Kaneko, H., Kawana, T., Fukushima, E., Suzutani, T., 2007. Tolerance of loop mediated isothermal amplification to a culture medium and biological substances, Journal of Biochemical and Biophysical Methods, 70, 499–501 Khezri, M., Pourbakhsh, S.A., Ashtari, A., Rokhzad, B., 2014. A survey of Mycoplasma agalactiae in small ruminants with contagious agalactiae syndrome in Iran, Bangldesh Journal of Veterinary Medicine, 12, 67-72 Kumar, A., Singh, M.K., Rana, R., Vihan, V.S., 2009. Post monsoon disease profile of Zalawadi goats, Indian Veterinary Journal, 86, 203-204 Kumar, A., Rahal, A., Chakraborty, S., Verma, A.K., Dhama, K., 2014a. Mycoplasma agalactiae, an Etiological Agent of Contagious Agalactia in Small Ruminants: A Review, Veterinary Medicine International, http://dx.doi.org/10.1155/2014/286752 Kumar, P., Roy, A., Aher, T.K., Joseph, J.P., 2014b. Biochemical and molecular identification of Mycoplasma agalactiae isolates from healthy and sick goats of Gujarat, The Indian Journal of Small Ruminants, 20, 59-63 Lin, G.Z., Zheng, F.Y., Zhou, J.Z., Gong, X.W., Wang, G.H., Cao, X.A., Qiu, C.Q., 2011. Loop-mediated isothermal amplification assay targeting the omp25 gene for rapid detection of Brucella spp, Molecular and Cellular Probes, 25, 126-129 Mair, G., Vilei, E.M., Wade, A., Frey, J., Unger, H., 2013. Isothermal loop-mediated amplification (LAMP) for diagnosis of contagious bovine pleuro-pneumonia, BMC Veterinary Research, 9, 108 McAuliffe, L., Ellis, R.J., Ayling, R.D., Nicholas, R.A.J., 2003. Differentiation of Mycoplasma Species by 16S Ribosomal DNA PCR and Denaturing Gradient Gel Electrophoresis Fingerprinting, Journal of Clinical Microbiology, 41, 4844-4847 Nagamine, K., Hase T., Notomi, T., 2002. Accelerated reaction by loopmediated isothermal amplification using loop primers, Molecular and Cellular Probes, 16, 223-229 Nirju, Z.K., 2012. Loop-mediated isothermal amplification technology: towards point of care diagnostics, PLoS Neglected Tropical Diseases, 6, e1572, doi:10.1371/journal.pntd.0001572 Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA, Nucleic Acids Research, 28, e63 OIE, 2013. Contagious agalactia. In: Terrestrial Manual. Chapter 2.7.5. http://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/2. 07.05_CONT_AGALACT.pdf. Accessed 29 Nov 2014. Parida, M., Sannarangaiah, S., Dash, P.K., Rao, P.V.L., Morita, K., 2008. Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique; perspectives in clinical diagnosis of infectious diseases, Reviews in Medical Virology, 18, 407-421 Peyraud, A., Woubit, S., Poveda, J.B., De la Fe, C., Mercier, P., Thiaucourt, F.A., 2003. Specific PCR for the detection of Mycoplasma

putrefaciens, one of the agents of the contagious agalactia syndrome of goats, Molecular and Cellular Probes, 17, 289–294 Saleh, M., Soliman, H., El-Matbouli, M., 2008. Loop-mediated isothermal amplification (LAMP) for rapid detection of Renibacterium salmoninarum, the causative agent of bacterial kidney diseases, Diseases of Aquatic Organisms, 81, 143-151 Sambrook, J. and Russel, D.W., 2001. Molecular Cloning, 3rd Ed, (Cold spring Harbor Laboratory Press, New York). Sanna, G., Lecca, V., Foddai, A., Tola, S., 2014. Development of a specific immunomagnetic capture-PCR for rapid detection of viable Mycoplasma agalactiae in sheep milk samples, Journal of Applied Microbiology, 117, 1585-1591 Song, Q., Wang, L., Fang, R., Khan, M.K., Zhou, Y., Zhao, J., 2012. Detection of Mycoplasma wenyonii in cattle and transmission vectors by the loop-mediated isothermal amplification (LAMP) assay, Tropical Animal Health and Production, DOI 10.1007/s11250- 0120197-y Thomas, A., Linden, A., Mainil, J., Dizier, I., Baseman, J.B., Kannan, T.R., Fleury, B., Frey, J., Vilei, E.M., 2004. The p40* adhesin pseudogene of Mycoplasma bovis, Veterinary Microbiology, 104, 213-217 Tola, S., Angioi, A., Rocchigiani, A.M.., Idini, G., Manunta, D., Galleri, G., Leori, G., 1997. Detection of Mycoplasma agalactiae in sheep milk samples by polymerase chain reaction, Veterinary Microbiology, 54, 17–22 Tsai, S.M., Chana, K.W., Hsub, W.L., Changa, T.J., Wonga, M.L., Wanga, C.Y., 2009. Development of a loop-mediated isothermal amplification for rapid detection of orf virus, Journal of Virological Methods, 157, 200–204 WAHIS, 2014. www.oie.int/wahis_2/public/wahid.php/Reviewreport/ Review?page_refer=MapFullEventReport&reportid=16436. Accessed 29 Nov 2014 Wang, D., Liu, F., Huo, G., Ren, D., Li, Y., 2008. Development and evaluation of a loop-mediated isothermal amplification method for detecting Escherichia coli O157 in raw milk, Advanced Materials Research, 343-344, 1217-1221 Wang, D., Yang, L., Huo, G., Wang, F., Li, Y., Ren, D., 2009. Development of a loop-mediated isothermal amplification (LAMP) method for detecting food-borne Shigella in raw milk, Milchwissenschaft, 64, 264-267 Wang, D., Zhang, G., Lu, C., Deng, R., Zhi, A., Guo, J., Zhao, D., Xu, Z., 2011. Rapid Detection of Listeria monocytogenes in Raw Milk with Loop-Mediated Isothermal Amplification and Chemosensor, Journal of Food Science, 76, 611-615 Yamazaki, W., Taguchi, M., Ishibashi, M., Nukina, M., Misawa, N., Inoue, K., 2009. Development of a loop-mediated isothermal amplification assay for sensitive and rapid detection of Campylobacter fetus, Veterinary Microbiology, 136, 393-396