Tumor Biol. DOI 10.1007/s13277-015-3978-x

ORIGINAL ARTICLE

G648C variant of DNA polymerase β sensitizes esophageal cancer to chemotherapy Yuanyuan Wang 1,2 & Qianqian Sun 1 & Wei Guo 3 & Xiaonan Chen 1 & Yuwen Du 1 & Wenqiao Zang 1 & Ziming Dong 1,2 & Guoqiang Zhao 1,2

Received: 16 July 2015 / Accepted: 24 August 2015 # International Society of Oncology and BioMarkers (ISOBM) 2015

Abstract Human DNA polymerase β (polβ) is a small monomeric protein that is essential for short-patch base excision repair. It plays an important role in regulating the sensitivity of tumor cells to chemotherapy. We have previously identified a G to C point mutation at nucleotide 648 (G648C) of polβ in esophageal cancer (EC). In this study, we evaluated the mutation of polβ in a larger cohort of EC patients by RT-PCR and sequencing analysis. The function of the mutation was evaluated by MTT, in vivo tumor growth, and flow cytometry assays. The G648C mutation occurred in 15 (3.45 %) of 435 EC patients. In addition, patients with this mutation had significantly longer survival time than those without, following postoperative chemotherapy. Cell lines with G648C mutation in polβ gene were more sensitive to treatment with 5fluorouracil and cisplatin than those with wild-type polβ. These results suggest that polβ gene with G648C mutation in surgically resected esophagus may be clinically useful for predicting responsiveness to chemotherapy in patients with EC. The polβ gene alteration may serve as a prognostic biomarker for EC.

Keywords Esophageal cancer . DNA polymerase β . Chemotherapy . Point mutation

* Guoqiang Zhao [email protected]

Introduction Human DNA polymerase β (polβ) is a small monomeric protein of 335 residues that is present in the nuclei of mammalian cells [1]. Polβ is a member of the DNA polymerase family and is essential for base excision repair (BER) [1–4]. BER is one of the major pathways of DNA repair [5]. polβ is also involved in meiotic recombination [6] and repair of doublestranded DNA breaks through the process of nonhomologous end joining [7]. Thirty percent of all tumors reported to date harbor mutations in the polβ gene [8]. Aberrant polβ expression results in an increased rate of spontaneous mutagenesis and a highly mutagenic tolerance phenotype [9, 10]. polβ gene mutation has been reported in various cancers [11–15]. Esophageal cancer (EC) is a major cause of cancer-related death worldwide and the fourth most lethal malignant tumor in China. Many previous studies have shown that polβ gene is mutated in primary EC tissues. EC also has varying degrees of sensitivity to chemotherapy in the clinic. In the present work, we identified a novel homozygous G to C point mutation at nucleotide 648 (G648C) in the polβ gene in a large cohort of EC patients with integral follow-up records and analyzed the relationship between aberrant polβ and patients’ chemotherapy features.

Materials and methods

1

College of Basic Medical Sciences, Zhengzhou University, No.100 Kexue Road, Zhengzhou, Henan 450001, China

Patients and tissue specimens

2

Collaborative Innovation Center of Cancer Chemoprevention of Henan, Zhengzhou, Henan 450001, China

3

Henan Academy of Medical and Pharmaceutical Sciences, Zhengzhou University, Zhengzhou, Henan 450052, China

The tissue specimens were obtained at the time of surgery from 435 patients with EC in the Oncology Hospital of Linzhou City, People’s Hospital in Linzhou City, and the First Affiliated Hospital of Zhengzhou University between 2000

Tumor Biol.

and 2008. Following pathologic identification, the tissues were snap-frozen in liquid nitrogen. All patients consented to the use of their tissue samples. None had received chemotherapy or radiotherapy before surgery. The 435 patients with complete information were followed up after surgery until March 1, 2014. This study was approved by the Ethics Committee of Zhengzhou University, and informed consent was obtained from each patient. Cell lines and culture Human EC cell line polβ null (polβ−/−) EC9706 was previously established in our laboratory [16]. All cells were maintained in RPMI 1640 medium supplemented with 10 % fetal bovine serum (FBS; Gibco BRL, Gaithersburg, MD, USA) and incubated at 37 °C in 5 % CO2. RNA isolation and RT-PCR Total RNA was isolated from EC tissue samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Approximately 1 μg total RNA was used for RT-PCR with 0.5 μg oligo (dt) primer for firststrand synthesis to generate cDNA. Next, the cDNAs were amplified using the following primers: polβ upstream: 5′ GTGCAGAGTCCAGTGGTGACA 3′; polβ downstream: 5′ CAGTTTTGGCTGTTTGGTTGATT 3′; β-actin upstream: 5′ TTCACTTCTTCAGTTCTGCCATCT 3′; β-actin downstream: 5′ CCAAGCTTTTCTCAGTCCCATAA 3′. The following thermal cycling conditions were used: denaturation at 94 °C for 5 min, followed by 36 cycles of denaturation at 94 °C for 35 s, annealing at 56 °C for 30 s, and extension at 72 °C for 35 s. PCR-amplified fragments were separated on 1.5 % agarose gel.

harvested 48 h after transfection and filtered through 0.22-μm cellulose acetate filters (Millipore, Billerica, MA, USA). Recombinant lentiviruses were concentrated by ultracentrifugation (2 h at 50,000×g). The titer of concentrated virus was measured in 293T cells according to the protocol. For lentiviral infection, the culture medium was removed when the polβ−/− EC9706 cells were at 60 % confluence. The cells were washed gently with PBS and treated with the viruscontaining medium (MOI=10) combined with Polybrene (5 μg/mL; Sigma, St. Louis, MO, USA). Cells were grown in DMEM or RPM 1640 containing 10 % FBS, with a change of medium every 48 h. Thus, the cells were subdivided into three groups: wild-type EC9706 cells (WT), G648C mutation EC9706 cells (G648C), and polβ null EC9706 cells (polβ−/−). MTT assay To confirm the effect of G648C on chemotherapy, an MTT colorimetric assay was performed in the three groups of EC9706 cells (WT, G648C, and polβ−/−). Test drug concentrations were 10–50 μg/mL for 5-fluorouracil (FU) and 1– 8 μg/mL for cisplatin. The cells were treated by a single or a variety of combinations. Cells were seeded onto a 96-well plate at 3×104 per well and were incubated overnight in complete medium. The attached cells in the plates were washed once with PBS, and the medium was replaced with fresh medium containing various concentrations of drugs. Cell viability was determined after 24 h of drug exposure using MTT solution (Cell Counting Kit-8; Dojindo, Kumamoto, Japan). Absorbance at 490 nm was measured using the Model 680 Microplate Reader (Bio-Rad, Hercules, CA, USA). The measurements for each sample were conducted in triplicate and the percentage of growth was the average of the experiments. In vivo tumor growth assay

DNA sequencing analysis PCR-amplified fragments were cloned into pGEM-T vectors and transformed into Escherichia coli DH5α, which were grown at 37 °C to mid-log phase. The DH5α transformants were subjected to sequencing analysis at Sangon Biotech (Shanghai). Lentivirus production and infection of cells Full-length wild-type and G648C mutant polβ were generated by PCR amplification. The fragments were cloned into the lentiviral vector (LV5) under control of the EF-1a promoter to construct the expression vectors LV5-G648C and LV5-WT. We respectively cotransfected 4.5 μg of the two lentiviral vectors with 3.5 μg PG-P2-REV/PG-P3-RRE and 1.5 μg PG-P1-VSVG plasmids into packaging cells (293T) using Lipofectamine 2000. Lentivirus-containing supernatants were

The three groups of EC9706 cells (WT, G648C, and polβ−/−) were respectively transfected with a luciferase-expressing lentivirus. EC9706-Luc cells (5×106) were subcutaneously inoculated into the armpit of the forelimb of 6-week-old female BALB/c nude mice purchased from The Laboratory Animal Unit of the University of Zhengzhou. When tumor volume was ∼100 mm3, mice were randomized into two groups of five: 5-FU group (10 mg/kg, once every 2 days for 4 weeks) and cisplatin group (3 mg/kg, once weekly for 4 weeks). Before the mice were anesthetized with isoflurane (Forane), an aqueous solution of luciferin (150 mg/kg) was injected intraperitoneally at 10 min prior to imaging. The mice were placed in the light-tight chamber of a CCD camera system (Xenogen). The luminescent area of the xenograft tumor was defined as the region of interest (ROI) and the total signal in the ROI (photon/s/m2) was quantified using Living Image software 3D (Xenogen). All procedures involving mice were

Tumor Biol.

performed in compliance with the Guide for the Care and Use of Laboratory Animals (National Institutes of Health). Apoptosis assay The three groups of EC9706 cells (WT, G648C, and polβ−/−) were incubated overnight in complete medium. The attached cells were washed once with PBS and then replaced with a fresh medium containing 5 μg/mL 5-FU or 0.5 μg/mL cisplatin according to clinical doses and results of pre-experiments. Cells were harvested at 48 h post-transfection by trypsinization. Cells were resuspended at 106 cells/mL in 1× binding buffer. After double-staining with fluorescein isothiocyanate (FITC)-annexin Vand propidium iodide (PI) using the FITC Annexin V Apoptosis Detection Kit I (BestBio, Shanghai, China), cells were analyzed using a FACScan flow cytometer (BD Biosciences, USA) equipped with Cell Quest software (BD Biosciences).

CA, USA). Following extensive washing, the membranes were incubated with diluted (1:3000) horseradish-peroxidaseconjugated goat anti-rabbit IgG (Santa Cruz Biotechnology). Signals were detected using a chemiluminescence detection kit (Amersham Pharmacia Biotech, Piscataway, NJ, USA). An antibody against GAPDH (Santa Cruz Biotechnology) served as an endogenous reference. Statistical analysis Statistical analysis was performed using SPSS 21.0 software. Data were expressed as the mean±standard deviation. Twotailed unpaired Student’s t test and one-way analysis of variance (ANOVA) was used to analyze data. Multiple comparison between the groups was performed using S–N–K method. The follow-up data were analyzed using the Kaplan–Meier method and log-rank test. P<0.05 was considered statistically significant.

Western blotting

Results The total protein from cultured cells was extracted using RIPA buffer containing phenylmethanesulfonyl fluoride. A BCA protein assay kit (Beyotime, Haimen, China) was used to determine protein concentrations. Fifty micrograms of protein of each group was subjected to SDS-PAGE and transferred onto polyvinylidene difluoride membranes. After blocking, the membranes were incubated overnight at 4 °C with diluted (1:500) primary antibody (polyclonal rabbit anti-pro-caspase3, anti-cleaved-caspase3; Santa Cruz Biotechnology, Santa Cruz, Fig. 1 Identification of the G648C mutation in ECs with DNA sequencing

G648C mutation is associated with response to postoperative chemotherapy and prolongs survival of EC patients In order to investigate the incidence of G648C mutation in EC, we established a new cohort of 435 EC patients. To facilitate large-scale G648C point mutation screening, a strategy based on PCR and DNA sequencing was designed to

Tumor Biol.

Fig. 2 Survival curves of ECs. a Patients with G648C mutation survival and the other survival enrolled. b Patients with G648C mutation survival and 15 patients with other polβ mutation survival enrolled. b Patients

with G648C mutation survival and 15 patients with wild-type polβ survival enrolled

characterize the mutation. The polβ mutation occurred in 183 (42.07 %) patients, and G648C point mutation occurred in 15 patients (Fig. 1) which take 8.20 % in 183 polβ mutation cases and 3.45 % among 435 ECs. We used the log-rank test to analyze the difference in survival rates between the patients with G648C mutation and the others, based on follow-up visits of EC patients. Patients with G648C mutation had longer survival than the others (P<0.05; Fig. 2a). Among the 435 patients, 347 received postoperative adjuvant chemotherapy with cisplatin (100 mg/m2 body surface area; day 1) and 5-FU (1000 mg/m2 body surface area; days 1–5), repeated every 28 days. Fifteen EC patients were randomly selected from patients with or without polβ mutation as they were diagnosed at the same clinicopathological stage before surgery and treated with the same chemotherapy. Kaplan–Meier method was used to analyze the difference in survival rates. The patients with G648C mutation had longer survival than patients with other polβ mutations (P<0.05; Fig. 2b) and those with wild-type polβ (P<0.05; Fig. 2c). Our data indicate that G648C mutation is associated with good response to postoperative chemotherapy.

inhibition effect of 5-FU and cisplatin in three group cells by MTT assay. The G648C cells were more sensitive to 5-FU and cisplatin than the WT cells (P<0.05; Fig. 3). The result supports the clinical observation that G648C mutation is associated with good response to postoperative chemotherapy of ECs.

G648C mutation enhanced the proliferation inhibition effect of chemotherapeutic agents in EC9706 cells To examine further the relationship between alternative polβ and response to anticancer drugs, we assessed the proliferation Fig. 3 Sensitivity of cell lines to cisplatin and 5-FU. Concentration of 5-FU and cisplatin was 10 to 50 μg/mL and 1 to 8 μg/mL, respectively. WT wild-type EC9706 cells, G648C G648C mutation EC9706 cells, polβ−/− polβ null EC9706 cells

G648C mutation enhanced the proliferation inhibition effect of chemotherapeutic agents in vivo Tumor growth assay was conducted to examine further the relationship between alternative polβ and good response to anticancer drugs (cisplatin and 5-FU). The bioluminescence signal of the G648C cells was relatively weaker than that of the WT and polβ−/− groups (P<0.05; Fig. 4). These results suggest that G648C mutation enhanced the proliferation inhibition effect of chemotherapeutic agents (cisplatin and 5-FU) in vivo. G648C mutation enhanced the apoptotic effect of chemotherapeutic agents in EC9706 cells We examined the apoptotic potential of 5-FU and cisplatin in the three group cells by flow cytometry and Western blotting. Flow cytometry indicated that, after treatment with 5-FU or cisplatin, the apoptosis levels of the G648C cells increased more significantly than in the WT and polβ−/− groups

Tumor Biol. Fig. 4 G648C mutation enhanced the proliferation inhibition effect of chemotherapeutic agents in vivo. a The bioluminescence signal of the G648C group cells was relatively weaker than WT and polβ−/− groups after treating with 5-FU. b The bioluminescence signal of the G648C group cells was relatively weaker than WT and polβ−/− groups after treating with cisplatin. WT wild-type EC9706 cells, G648C G648C mutation EC9706 cells, polβ−/− polβ null EC9706 cells

EC is a major cause of cancer-related death worldwide. Each year, ∼30 million people worldwide die from the disease. Although the diagnosis and treatment of EC have advanced, the disease progresses quickly and has a poor prognosis caused by invasion and early metastasis [17, 18]. Due to the potential difficulties that surgery might impose on patients and surgeons, most patients with advanced EC choose to undergo

palliative treatment instead. Chemotherapy is one of the main palliative treatments for EC. However, the clinical efficacy of chemotherapy is not satisfactory, as demonstrated by a 5-year survival rate of only 10–30 % and a local tumor uncontrolled rate and recurrence rate reaching up to 60–80 % [19, 20]. Therefore, improving the efficacy of chemotherapy is the current focus of research. In recent years, some studies have found a variety of genes whose expression products can affect tumor chemotherapy; examples include cell cycle regulatory genes, apoptotic genes, and DNA damage repair proteins [21–23]. polβ is the primary polymerase involved in BER, through its bifunctional deoxyribose phosphate lyase and polymerase activities, and it is an important factor for maintaining genomic integrity and stability [24]. polβ fills in a single nucleotide gap and catalyzes removal of the dRP group [25–27].

Fig. 5 G648C mutation enhanced chemotherapeutic agents’ apoptosis effect in EC9706 cells. a Post treatment with 5-FU or cisplatin, the apoptosis levels of the G648C group increased much more significantly when compared to the WT and polβ−/− groups (P < 0.05). b The

expression level of cleaved caspase3 was increased in the G648C group compared with the WT and polβ−/− groups (P<0.05). WT wild-type EC9706 cells, G648C G648C mutation EC9706 cells, polβ−/− polβ null EC9706 cells

(P<0.05; Fig. 5a). Western blotting showed that expression of cleaved caspase 3 was increased in the G648C cells compared with the WT and polβ−/− cells (P<0.05; Fig. 5b). These results suggest that G648C mutation enhanced the apoptotic effect of chemotherapeutic agents in EC9706 cells.

Discussion

Tumor Biol.

Approximately 30 % of human tumors examined for mutations in polβ appear to express polβ variants [28]. Many of these variants result from a single amino acid substitution. The present study presents a comprehensive picture of the G648C mutation of polβ gene in EC patients. The G648C mutation was associated with chemotherapy. Previous studies have suggested that polβ exhibits dichotomous functions depending on its expression, either as an oncogene or as a tumor suppressor gene [29–31]. In order to investigate the incidence of G648C mutation in EC, we established a new cohort of 435 EC patients. The polβ mutation was detected in 183 (42.07 %) of them. Among 183 polβ mutation cases, G648C point mutation was detected in 15 patients (8.20 %). The patients with G648C mutation had longer survival than the others. Our clinical and experimental data indicate that G648C mutation has an anticancer property, and in comparison to the wild-type polβ gene in EC, it may prolong survival of EC patients. The results of MTT and in vivo tumor growth assays indicated that G648C mutation enhanced the proliferation inhibition effect of chemotherapeutic agents. The results of flow cytometry and Western blotting showed that G648C mutation enhanced the apoptotic effect of chemotherapeutic agents in EC9706 cells. These results support the clinical observation that G648C mutation is associated with good response to postoperative chemotherapy of ECs. This study confirms that the G648C variant of polβ sensitizes EC patients to chemotherapy. Thus, the polβ gene with G648C mutation in surgically resected primary esophageal tissues may be clinically useful for predicting responsiveness to chemotherapy in patients with EC. The polβ gene alteration may serve as a prognostic biomarker for EC.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17. 18. 19.

Acknowledgments This study was supported by National Natural Science Foundation of China (No. 81272188). Conflicts of interest None

20.

References

21. 22.

1. 2.

3.

4.

5.

Goodman MF. Error-prone repair DNA polymerases in prokaryotes and eukaryotes. Annu Rev Biochem. 2002;71:17–50. Nowak R, Woszczynski M, Siedlecki JA. Changes in the DNA polymerase beta gene expression during development of lung, brain, and testis suggest an involvement of the enzyme in DNA recombination. Exp Cell Res. 1990;191:51–6. Krahn JM, Beard WA, Wilson SH. Structural insights into DNA polymerase beta deterrents for misincorporation support an induced-fit mechanism for fidelity. Structure. 2004;12(10):1823– 32. Prasad R, Batra VK, Yang XP, Krahn JM, Pedersen LC, Beard WA, et al. Structural insight into the DNA polymerase beta deoxyribose phosphate lyase mechanism. DNA Repair (Amst). 2005;4(12): 1347–57. Friedberg EC. DNA damage and repair. Nature. 2003;421:436–40.

23.

24.

25.

Kidane D, Jonason AS, Gorton TS, Mihaylov I, Pan J, Keeney S, et al. DNA polymerase beta is critical for mouse meiotic synapsis. EMBO J. 2010;29:410–23. Wilson TE, Lieber MR. Efficient processing of DNA ends during yeast nonhomologous end joining. Evidence for a DNA polymerase b (Pol4)-dependent pathway. J Biol Chem. 1999;274:23599–609. Dalal S, Chikova A, Jaeger J, Sweasy JB. The Leu22Pro tumorassociated variant of DNA polymerase beta is dRP lyase deficient. Nucleic Acids Res. 2008;36:411–22. Canitrot Y, Hoffmann JS, Calsou P, Hayakawa H, Salles B, Cazaux C. Nucleotide excision repair DNA synthesis by excess DNA polymerase beta: a potential source of genetic instability in cancer cells. FASEB J. 2000;14:1765–74. Srivastava DK, Husain I, Arteaga CL, Wilson SH. DNA polymerase beta expression differences in selected human tumors and cell lines. Carcinogenesis. 1999;20:1049–54. Bhattacharyya N, Chen HC, Comhair S, Erzurum SC, Banerjee S. Variant forms of DNA polymerase beta in primary lung carcinomas. DNA Cell Biol. 1999;18:549–54. Dobashi Y, Shuin T, Tsuruga H, Uemura H, Torigoe S, Kubota Y. DNA polymerase beta gene mutation in human prostate cancer. Cancer Res. 1994;54:2827–39. Miyamoto H, Miyagi Y, Ishikawa T, Ichikawa Y, Hosaka M, Kubota Y. DNA polymerase beta gene mutation in human breast cancer. Int J Cancer. 1999;83:708–19. Wang L, Patel U, Ghosh L, Banerjee S. DNA polymerase beta mutations in human colorectal cancer. Cancer Res. 1992;52: 4824–7. Zhao GQ, Wang T, Zhao Q, Yang HY, Tan XH, Dong ZM. Mutation of DNA polymerase beta in esophageal carcinoma of different regions. World J Gastroenterol. 2005;11:4618–22. Feng L, Ma YY, Zhao GQ, Li M, Sun SJ, Dong ZM, et al. Establishment and characterization of DNA pol beta knockout human esophageal carcinoma cell line EC9706. Life Sci J. 2010;7: 13–8. Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin. 2014;64:9–29. Parkin DM, Pisani P, Ferlay J. Estimates of the worldwide incidence of 25 major cancers in 1990. Int J Cancer. 1999;80:827–41. Li M, Zang W, Wang Y, Ma Y, Xuan X, Zhao J, et al. DNA polymerase beta mutations and survival of patients with esophageal squamous cell carcinoma in Linzhou City, China. Tumour Biol. 2014;35:553–9. Li M, Zang W, Wang Y, Li Y, Ma Y, Wang N, et al. DNA polymerase beta promoter mutations and transcriptional activity in esophageal squamous cell carcinoma. Tumour Biol. 2013;34: 3259–63. Hiwasa T, Tokita H, Ike Y. Differential chemosensitivity in oncogene-transformed cells. J Exp Ther Oncol. 1996;1:162–70. Vogt U, Falkiewicz B, Bielawski K, Bosse U, Schlotter CM. Relationship of c-myc and erbB oncogene family gene aberrations and other selected factors to ex vivo chemosensitivity of ovarian cancer in the modified ATP-chemosensitivity assay. Acta Biochim Pol. 2000;47:157–64. Falkiewicz B, Schlotter CM, Bosse U, Bielawski K, Vogt U. c-myc oncogene gene dosage, serum CEA and CA-15.3 antigen levels, and cellular DNA values in relation to ex vivo chemosensitivity of primary human breast cancer. Acta Biochim Pol. 2000;47:149–56. Wang Y, Chen X, Hu X, Zhang R, Du Y, Zang W, et al. Enhancement of silencing DNA polymerase β on the radiotherapeutic sensitivity of human esophageal carcinoma cell lines. Tumour Biol. 2014;35(10):10067–74. Demple B, Sung JS. Molecular and biological roles of Ape1 protein in mammalian base excision repair. DNA repair (Amst). 2005;4: 1442–9.

Tumor Biol. 26.

McCullough AK, Dodson ML, Lloyd RS. Initiation of base excision repair: glycosylase mechanisms and structures. Annu Rev Biochem. 1999;68:255–85. 27. Matsumoto Y, Kim K. Excision of deoxyribose phosphate residues by DNA polymerase beta during DNA repair. Science. 1995;269: 699–702. 28. Starcevic D, Dalal S, Sweasy JB. Is there a link between DNA polymerase beta and cancer? Cell Cycle. 2004;3:998–1001.

29.

30.

31.

Poltoratsky V, Prasad R, Horton JK, Wilson SH. Down-regulation of DNA polymerase beta accompanies somatic hypermutation in human BL2 cell lines. DNA Repair (Amst). 2007;6:244–53. Singhal RK, Prasad R, Wilson SH. DNA polymerase beta conducts the gap-filling step in uracil-initiated base excision repair in a bovine testis nuclear extract. J Biol Chem. 1995;270:949–57. Sweasy JB, Lang T, DiMaio D. Is base excision repair a tumor suppressor mechanism? Cell Cycle. 2006;5:250–9.