Dig Dis Sci DOI 10.1007/s10620-015-4029-6

ORIGINAL ARTICLE

Orai1, a Direct Target of microRNA-519, Promotes Progression of Colorectal Cancer via Akt/GSK3b Signaling Pathway Wei Deng1,2 • Jin Wang1,2 • Jun Zhang1,2 • Jun Cai1,2 • Zhigang Bai1,2 Zhongtao Zhang1,2

•

Received: 16 September 2015 / Accepted: 30 December 2015 Ó Springer Science+Business Media New York 2016

Abstract Background Orai1, which is involved in store-operated calcium entry, has recently been implicated in cancer progression. However, the role of Orai1 in colorectal cancer (CRC) progression remains unclear. Methods We used real-time PCR and western blot to measure Orai1 expression in four CRC cell lines, 60 tumor pairs, and corresponding non-tumor tissues from CRC patients. Immunohistochemistry was performed to examine Orai1 expression in CRC and corresponding non-tumor tissues. Statistical analyses were applied to evaluate the prognostic value and associations of Orai1 expression with clinical parameters. Furthermore, the Orai1 gene was overexpressed in HCT116 cell and silenced with siRNA in LOVO cell. Moreover, cell proliferation and apoptosis were measured using MTT assay and flow cytometry, and a molecular mechanism of Orai1 regulation by miR-519 was explored. Results Orai1 expression was higher in CRC tissues than adjacent non-cancerous tissues, and this was positively correlated in CRC patients with distant metastasis and poor prognosis. Also, increased expression of Orai1 was observed in highly invasive CRC cell lines and ectopic expression of Orai1 enhanced cell proliferation and inhibited apoptosis; silencing Orai1 suppressed cell proliferation and induced apoptosis. The Akt/GSK3b

& Zhongtao Zhang [email protected] 1

Department of General Surgery, Beijing Friendship Hospital, Capital Medical University, 95 Yongan Road, Xicheng District, Beijing 100050, China

2

National Clinical Research Center of Digestive Diseases, Beijing 100050, China

pathway contributed to Orai1 effects in CRC cells, and Orai1 was a direct target of miR-519, a microRNA not previously reported to be involved in both CRC tissues and cell lines. Conclusions We identified a novel CRC regulatory circuit involving the miR-519-Orai1 axis, and dysfunction of this drives diverse aspects of CRC pathogenesis. Keywords Colorectal cancer  Orai1  Apoptosis  miR519  Akt/GSK3b pathway

Introduction Colorectal cancer (CRC) is one of the most prevalent human malignant tumors worldwide and is the second leading cause of death from cancer among adults [1]. Surgical resection is an important curative treatment for CRC, and chemotherapy is a critical adjuvant for CRC therapy [2]. However, long-term prognosis after surgery remains unsatisfactory due to high rates of recurrence and metastases [3]. Thus, understanding molecular mechanisms underlying CRC is necessary for developing novel anticancer therapies. Cancer research is beginning to focus on intracellular Ca2? signaling pathways involved in carcinogenesis and tumor progression [4]. Evidence suggests that altered Ca2? signaling contributes to tumor angiogenesis and progression genes that promote such alterations are novel targets for cancer therapy [5]. In non-excitable cells, the storeoperated calcium entry (SOCE) is a major mechanism of Ca2? influx and a ubiquitous mechanism mediating many fundamental physiological processes, such as cell proliferation, migration, and apoptosis [6]. The two key components are documented to be responsible for SOCE

123

Dig Dis Sci

activation: stromal interaction molecule 1 (STIM1) and Orai1 [7]. And calcium release-activated calcium channel protein 1 is a calcium selective ion channel that in humans is encoded by the Orai1 gene [8]. Recent studies suggest that SOCE is a key to tumor cell progression [9] and transient receptor potential cation channel subfamily M member 7 (TRPM7)-mediated Ca2? signals are reported to promote cancer invasion and metastases [10]. Yang et al. [11] found that Orai1 is shown to be critical for breast tumor cell migration and metastasis. Chen et al. [12] reported that Orai1 expression is higher in cervical cancer tissues compared to adjacent normal tissues. Recently, elevated Orai1 expression mediates tumor-promoting intracellular Ca2? oscillations in human esophageal squamous cell carcinoma [13]. More recently, overexpression of Orai1 was shown to mediate cell proliferation and to be associated with poor prognosis in human nonsmall cell lung carcinoma [14]. Thus, Orai1 may be important to cancer progression, but how this works in CRC is unclear. MiR-519 was recently reported to inhibit cell proliferation and subsequently trigger senescence and decrease tumor growth [15]. Moreover, miR-519 can perturb intracellular calcium levels via miR-519 influences on proteins that affect calcium homeostasis, including Orai1 [16]. Here, we report that Orai1 overexpression is associated with progression and poor prognosis in CRC and ectopic expression of Orai1 enhanced cell proliferation and inhibited apoptosis. Further investigations indicated that Orai1 is a direct target of miR-519, a microRNA that has previously been shown to inhibit growth and cell survival. Thus, the miR-519-Orai1 axis may be a diagnostic marker and a potential therapeutic target for treating CRC.

Materials and Methods Patient Specimens Clinical CRC samples were obtained from CRC patients who had undergone proctocolectomy at the General Surgery Department of Beijing Friendship Hospital. Written informed consents were obtained from the subjects who participated in this study. The primary tumor samples and corresponding non-tumor mucosa were collected from each patient immediately after the surgical process and were snap-frozen in liquid nitrogen until further use. Cell Culture The CRC cell lines HCT116, SW480, SW1116, and LOVO were purchased from the Shanghai Cell Biology,

123

University of the Chinese Academy of Sciences. These cell lines were routinely maintained in RPMI-1640 medium supplemented with 10 % fetal bovine serum at 37 °C in a humidified air atmosphere containing 5 % carbon dioxide. Throughout the experiment, cells were used in the logarithmic phase of growth according to the supplier’s instructions. Western Blot Analysis Western blot analysis was performed as described [17]. In brief, equal amounts of protein were separated by 10 % SDS-PAGE before transfer to nitrocellulose membranes (Millipore), which were incubated with the primary antibodies anti-Orai1 (1:1000, Abcam), anti-phosphorylated AKT (1:1000, CST), anti-total AKT (1:1000, CST), antiphosphorylated GSK3b (1:1000, CST), anti-total GSK3b (1:1000, CST), and anti-GAPDH (1:1000, Santa Cruz) at 4 °C overnight. Then, they were blotted for 1 h at room temperature with the help of an appropriate secondary antibody. Thereafter, ECL reagents were used to visualize bands (Pierce, USA), and signals were measured. Immunohistochemical Staining Sections were blocked using serum-free protein block buffer (DAKO, CA, USA) for 30 min and incubated with anti-Orai1 (1:1000, Abcam) and rabbit IgG or rabbit serum instead of primary antibody which was used as negative control (Abcam, Cambridge, MA). The pictures were recorded using a Nikon light microscope, and staining intensity analyzed using Nikon software (Nikon Inc., Melville, NY, USA). RNA Isolation, Reverse Transcription, and Quantitative Real-Time PCR Total RNA from the frozen tissues was isolated with TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions and was quantified with SYBR Green assays with RT primers and SYBR Green from Takara Biotechnology (TAKARA, Dalian, China). Human GAPDH was amplified in parallel as an internal control. The following are the primer sequences. Orai1: forward 50 -ACGTGCACAATCTCAACTCG-30 and reverse 50 -AG CACCACCTCAGCTAGG AA-30 . GAPDH, 50 -GGGCGC CTGGTCACCAGGGCTG-30 and reverse 50 -GGGGCCA TCCACAGTCTTCTG-30 . Mature miR-519 was quantified using QuantiMir RT. Primers used were AAAGTGCATC CTTTTAGAGTGT for miR-519. Data were normalized to U6 using specific primer CGACTGCATAATTTGTGGTA GTGG.

Dig Dis Sci

siRNA Transfection and Clone Selection

Results

The RNA duplexes for siRNA-mediated Orai1 silencing were synthesized by Genepharma Company (Shanghai, China). Transfection of the siRNAs in CRC cells was performed using Lipofectamine RNAiMAX transfection reagent (Invitrogen) following the manufacturer’s recommended protocol. Plates were incubated for 48 h until ready for assays. Full-length human Orai1 cDNA was purchased from GeneCopeia (Rockville, MD, USA). Then, we constructed lentiviral vectors encoding the full-length Orai1 cDNA in GV166 vector (Genepharma Company, China) and designated this as LV-Orai1. An empty vector was used as the negative control.

Orai1 Expression Is Positively Correlated with the Progression and Outcome of CRC

Cell Proliferation and Apoptosis Assays The effect of Orai1 on cell viability was measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Cell viability was expressed as a percentage of maximum absorbance of purple formazan at 560 nm from five replicates in three independent experiments. Cells were harvested at an exponential growth phase, and single-cell suspensions containing 1 9 106 cells were fixed with 70 % alcohol. Apoptotic cells were evaluated by Annexin-V fluorescein isothiocyanate and propidium iodide apoptosis detection kit (BD Biosciences, USA) according to the manufacturer’s protocol. Stained cells were then analyzed with a FACScan flow cytometer, and the data were analyzed using FlowJo software (Tree Star Inc., USA). Calcium Entry Assays Calcium entry assays were performed as described previously [18]. Briefly, for measurement of store-operated Ca2? influx, 2 mM thapsigargin was added to deplete internal calcium stores. Ca2? influx was induced by subsequent addition of 2 mM Ca2? after store depletion. Statistical Analysis All data are expressed in terms of means ± the SEM. Significant differences were analyzed using Student’s t test and two-tailed distribution. Data were considered statistically significant if P \ 0.05. The Mann–Whitney U test was used to analyze the relationship between Orai1 expression and clinicopathological characteristics. Cumulative survival time was calculated by the Kaplan–Meier method and analyzed by the log-rank test.

To investigate the potential role of Orai1 in determining the outcome of CRC, we first examined Orai1 expression in 60 CRC tissue samples and non-tumor tissues by western blot. As shown in Fig. 1a, Orai1 expression was significantly overexpressed in CRC tissues compared with matched adjacent non-tumor tissues. Upregulation of Orai1 expression in CRC tumors was further confirmed with immunohistochemical (IHC) of human CRC specimens (Fig. 1b). Positive Orai1 expression was assessed in 43 of 60 (72 %) primary CRC samples compared with only 11 of 60 (19 %) adjacent non-tumor tissues. These findings obviously indicated that Orai1 is overexpressed in CRC. Next, we analyzed the association between Orai1 expression and clinicopathological parameters in 60 CRC patients (Table 1). The results show that overexpression of Orai1 did not correlate with age, gender, and tumor size (P [ 0.05), but was significantly associated with advanced clinical stage (P = 0.034) and high incidence of metastasis (P = 0.021). Taken together, these results indicate that Orai1 overexpression is positively correlated with the CRC progression and is indicative of poor prognoses. Orai1 Promotes Tumor Cell Growth and Inhibits Apoptosis To further investigate the biological role of Orai1 in CRC, we examined the expression of Orai1 in four human CRC cell lines (SW480, SW1116, HCT116, and LOVO) and in a normal human intestinal epithelial cell line (HIEC). As shown in Fig. 2a, we found that Orai1 expression was significantly increased in SW1116 and LOVO cells, which have highly metastatic propensities, compared with either the less metastatic cell lines SW480 or HCT116 or HIEC cell. Next, LOVO cells were transfected with Orai1specific siRNA or control siRNA. HCT116 cells were infected with recombinant lentivirus expressing Orai1 (LVOrai1) or a control lentivirus (LV-NC). As shown in Fig. 2b, knockdown and upregulation of Orai1 expression was confirmed by western blot. Our data indicate that Orai1-overexpressing cells had greater proliferation than vector-transfected cells and downregulation of Orai1 inhibited tumor growth (Fig. 2c, d). We further examined the effect of Orai1 on CRC cell apoptosis. As shown in Fig. 2e, f, after silencing Orai1 expression in LOVO cell, annexin-V/propidium iodide staining assay confirmed increased apoptosis in LOVO-Orai1 siRNA#1 and LOVOOrai1 siRNA#2 groups, compared with controls.

123

Dig Dis Sci

Fig. 1 Orai1 overexpression in CRC clinical samples. A Western blot of Orai1 protein quantification in 8 CRC specimens and corresponding non-tumor mucosal tissues. GAPDH was a loading control. B Representative images of Orai1 staining in 60 paired CRC

tissues. a, b Primary sites of non-metastatic CRC; c, d primary sites of metastatic CRC; and e, f non-cancerous region of CRC. a, c, e Magnification, 9200; b, d, f magnification, 9400. Scale bar 100 lm

Table 1 Clinicopathological correlation of Orai1 expression in 60 CRC patients

the overexpression or knockdown of Orai1 could influence the phosphorylation level of GSK3b. Triciribine is a potent, small-molecule inhibitor of activation of all three isoforms of AKT in vitro [21]. As shown in Fig. 3c, we found that Orai1’s effect on the regulation of GSK3b could be partly abolished by triciribine and enhanced proliferative capacity in CRC cells due to upregulation of Orai1 was significantly suppressed by triciribine (Fig. 3d). Ca2? influx was then measured by addition of 2 mM extracellular Ca2?, and Orai1 siRNAs reduced the level of Ca2? influx compared to control siRNA in LOVO cells (Fig. 3e). But overexpression of Orai1 constructs increased the Ca2? influx in HCT116 cells (Fig. 3f). Therefore, the Akt/GSK3b pathway is a downstream component of Orai1 and contributes to the effects of Orai1 in CRC cells.

Variables

All cases

Orai1 expression High

P value

Low

Age (years) B50

22

12

10

[50

38

26

12

0.085

Sex Male

42

27

15

Female

18

11

7

0.876

Tumor size (cm) B5

21

13

8

39

27

12

I–II

36

26

10

III–IV

24

14

10

[5 TNM stage

0.453

0.034

Orai1 Is a Direct Functional Target of miR-519 in CRC Cells and Tissues

Metastasis Absent

25

14

11

Present

35

28

7

0.021

Akt/GSK3b Pathway Is a Downstream Component of Orai1 in CRC Cells The Akt signaling pathway was reported to have a role in various cellular functions, including proliferation and apoptosis [19]. Our data show that phosphorylated Akt was significantly elevated in Orai1-overexpressing cells, whereas it was reduced in Orai1-knockdown cells (Fig. 3a, b). Activated Akt could regulate many downstream targets, such as GSK3b, and eventually influence cell proliferation and apoptosis [20]. As shown in Fig. 3a, b, we found that

123

Recently, miRNAs were reported to have a crucial role in tumor progression through their function as posttranscriptional regulators [22]. Thus, we studied whether miRNAs represent an upstream regulatory mechanism of Orai1 expression in CRC. Previous work indicates that one subset of miR-519 target mRNAs encoded proteins that control intracellular calcium in HeLa cells, and these included the Orai1 gene [15]. We measured endogenous miR-519 expression levels in CRC cell lines (SW480, SW1116, HCT116, and LOVO) and HIEC cell using qRT-PCR. As shown in Fig. 4a, the expression level of miR-519 was significantly decreased in SW1116 and LOVO cell lines (highly metastatic cells) compared with either poorly metastatic or immortalized cells. Furthermore, our results

Dig Dis Sci

Fig. 2 Orai1 promoted CRC cells proliferation and inhibited apoptosis in vitro. a Western blot of Orai1 expression in different CRC cell lines. GAPDH was used as a loading control. b After cells were infected with siOrai1#1, or #2 or LV-Orai1 vector (clone1 and clone2), Orai1 protein expression was detected by western blot. GAPDH was used as a loading control. c, d Orai1-knockdown cells had less proliferation than negative controls, whereas Orai1-

overexpressing cells had significant proliferative advantage compared with vector-transfected cells. e Representative diagrams of annexinV/PI assay are shown in each group. f Quantification of annexin-V and PI flow cytometry. The percentage of the annexin-V-positive cell population was determined. *P \ 0.05, compared with the vectortransfected group

indicate that the expression of miR-519 and Orai1 was inversely correlated in the CRC cells (Fig. 4b). To investigate the correlation of miR-519 with Orai1 expression levels in CRC tissues, qRT-PCR was used to measure expression of miR-519 in 25 CRC tissues. As shown in Fig. 4c, d, miR-519 mRNA was negatively correlated with Orai1 expression. These data strongly suggest that miR519 is one of the upstream molecules regulating Orai1 expression in CRC.

Intracellular Ca2? oscillations are thought to serve as ‘‘calcium code’’ to initiate many biological processes, such as cell proliferation [23]. However, how changes in concentration of Ca2? are initiated in various cancer cells is undefined. In this study, we studied the clinical relevance of Orai1 and noted that Orai1 expression was increased in CRC tissues and that upregulation of Orai1 expression was correlated with a high metastatic potential of CRC cells. A previous study agreed with these conclusions revealing that Orai1 was significantly associated with metastatic risk in cervical cancer [24]. Therefore, Orai1 upregulation may assist us to identify new cancer therapy targets. Akt signaling is known to be involved in cell proliferation, survival, and apoptosis and modulate the progression of various tumors [25]. Our findings suggest that Akt signaling is responsible for Orai1-mediated tumor cell proliferation and apoptosis, along with hyperphosphorylation of GSK3b. Also, inhibition of this pathway with an Akt inhibitor reduced proliferative activity of Orai1-overexpressing CRC cells. Moreover, our results linked Ca2? entry inhibition to decreased Akt phosphorylation which may be an underlying cause of increased apoptosis. A prior study demonstrated that reduced SOCE is linked to cell apoptosis due to decreased vesicle trafficking to the plasma

Discussion The present report is the first to reveal an oncogenic role for Orai1 in CRC, a major cause of cancer death worldwide. Our results indicate that Orai1 expression was significantly elevated in tumors obtained from patients with CRC, compared with that in neighboring non-tumor tissues. We also found that upregulation of Orai1 expression enhanced CRC cells proliferation and inhibited apoptosis, whereas knockdown of Orai1 suppressed CRC cells proliferation and induced apoptosis. Additionally, high Orai1 expression in CRC is at least partly attributed to posttranscriptional regulation by miR-519.

123

Dig Dis Sci Fig. 3 Akt/GSK3b pathway is involved in Orai1-mediated modulation of CRC cells. a, b Western blot of p-Akt, total Akt, p-GSK3b, total GSK3b, and GAPDH expression in Orai1-silenced LOVO cells and Orai1-overexpressing HCT116 cells. c Western blot of p-Akt, total Akt, p-GSK3b, total GSK3b, and GAPDH expression in Orai1overexpressing HCT116 cells after incubation with triciribine (10 mm) for 24 h. d In vitro growth assay of Orai1transfected or vector-transfected cells with triciribine (10 mm) treatment. e Fluo-3 Ca2? measurement indicates that Orai1 siRNA decreased storeoperated Ca2? influx in LOVO cells. f Fluo-3 Ca2? measurement indicates that overexpression of Orai1 increases Ca2? influx in HCT116 cells. TAG, thapsigargin. Ca2?, 2 mM Cacl2

membrane [26]. Also, Ca2? entry is reported to be vital to cell cycle G0/G1 phase progression and activation of NFjB pathways [27]. Specifically, NF-jB is associated with activated Akt, allowing unlimited cell division and cell evasion of apoptosis [28]. However, whether Orai1 is important in other malignancies via the Akt/GSK3b pathway is uncertain and data from those studies would help us to better understand the influence of Orai1 in CRC. microRNAs (miRNAs) are small, single-stranded, endogenous noncoding RNAs that posttranscriptionally regulate gene expression by binding to the 30 -UTR of target mRNAs [29]. miRNAs have been implicated in biological processes including cell proliferation, apoptosis, and response to stress [30]. Recent reports have demonstrated

123

that dysregulation of miRNAs is associated with carcinogenesis and tumor progression [31]. Importantly, miRNAs are considered potential diagnostic biomarkers and perhaps therapeutic targets [32]. We report that miR-519 expression inversely correlated with the expression of Orai1 in both CRC cells and tissues. Consistent with our findings, miR519 has also been reported to be involved in cell proliferation in colorectal cancer, ovarian, and cervical cancer [33]. Whether miR-519 represses expression of other proliferative proteins in cancer remains to be elucidated. In conclusion, Orai1 is necessary to CRC progression as it is a functional target of miR-519. Thus, the miR-519Orai1 pathway is an attractive target for therapeutic intervention to treat CRC.

Dig Dis Sci Fig. 4 Expression of Orai1 and miR-519 negatively correlates in CRC cell lines and clinical samples. a Expression of miR519 and Orai1 in CRC cells was analyzed by qPCR assays. b Scatter plots showing the negative linear correlation between miR-519 expression and Orai1 expression in CRC cells. c qPCR analysis of the expression of miR-519 and Orai1 in 25 CRC specimens. d Scatter plots showing the negative linear correlation between miR-519 expression and Orai1 expression in CRC tissues

Acknowledgments We thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript. This study was supported by grants from the National Natural Science Foundation of China (No. 51320154). Compliance with ethical standards Conflict of interest

None.

References 1. Center MM, Jemal A, Smith RA, Ward E. Worldwide variations in colorectal cancer. CA Cancer J Clin. 2009;59:366–378. 2. Chibaudel B, Tournigand C, Andre T, de Gramont A. Therapeutic strategy in unresectable metastatic colorectal cancer. Ther Adv Med Oncol. 2012;4:75–89. 3. Zheng L, Zhang Y, Liu Y, et al. MiR-106b induces cell radioresistance via the PTEN/PI3K/AKT pathways and p21 in colorectal cancer. J Transl Med. 2015;13:252. 4. Prevarskaya N, Skryma R, Shuba Y. Calcium in tumour metastasis: new roles for known actors. Nat Rev Cancer. 2011;11:609–618. 5. Parkash J, Asotra K. Calcium wave signaling in cancer cells. Life Sci. 2010;87:587–595.

6. Roberts-Thomson SJ, Peters AA, Grice DM, Monteith GR. ORAI-mediated calcium entry: mechanism and roles, diseases and pharmacology. Pharmacol Ther. 2010;127:121–130. 7. Parekh AB. Store-operated CRAC channels: function in health and disease. Nat Rev Drug Discovery. 2010;9:399–410. 8. Song K, Zhong XG, Xia XM, et al. Orai1 forms a signal complex with SK3 channel in gallbladder smooth muscle. Biochem Biophys Res Commun. 2015;466:456–462. 9. Fedida-Metula S, Feldman B, Koshelev V, Levin-Gromiko U, Voronov E, Fishman D. Lipid rafts couple store-operated Ca2? entry to constitutive activation of PKB/Akt in a Ca2?/calmodulin, Src- and PP2A-mediated pathway and promote melanoma tumor growth. Carcinogenesis. 2012;33:740–750. 10. Davis FM, Azimi I, Faville RA, et al. Induction of epithelialmesenchymal transition (EMT) in breast cancer cells is calcium signal dependent. Oncogene. 2014;33:2307–2316. 11. Yang S, Zhang JJ, Huang XY. Orai1 and STIM1 are critical for breast tumor cell migration and metastasis. Cancer Cell. 2009;15:124–134. 12. Chen YF, Chiu WT, Chen YT, et al. Calcium store sensor stromal-interaction molecule 1-dependent signaling plays an important role in cervical cancer growth, migration, and angiogenesis. Proc Natl Acad Sci USA. 2011;108:15225–15230. 13. Zhu H, Zhang H, Jin F, et al. Elevated Orai1 expression mediates tumor-promoting intracellular Ca2? oscillations in human esophageal squamous cell carcinoma. Oncotarget. 2014;5:3455–3471.

123

Dig Dis Sci 14. Zhan ZY, Zhong LX, Feng M, Wang JF, Liu DB, Xiong JP. Over-expression of Orai1 mediates cell proliferation and associates with poor prognosis in human non-small cell lung carcinoma. Int J Clin Exp Pathol. 2015;8:5080–5088. 15. Abdelmohsen K, Kim MM, Srikantan S, et al. miR-519 suppresses tumor growth by reducing HuR levels. Cell Cycle (Georgetown, Tex.). 2010;9:1354–1359. 16. Abdelmohsen K, Srikantan S, Tominaga K, et al. Growth inhibition by miR-519 via multiple p21-inducing pathways. Mol Cell Biol. 2012;32:2530–2548. 17. Qin Y, Wang J, Gong W, et al. UHRF1 depletion suppresses growth of gallbladder cancer cells through induction of apoptosis and cell cycle arrest. Oncol Rep. 2014;31:2635–2643. 18. Cvejic S, Zhu Z, Felice SJ, Berman Y, Huang XY. The endogenous ligand Stunted of the GPCR Methuselah extends lifespan in Drosophila. Nat Cell Biol. 2004;6:540–546. 19. Tommasi S, Pinto R, Pilato B, Paradiso A. Molecular pathways and related target therapies in liver carcinoma. Curr Pharm Des. 2007;13:3279–3287. 20. Liu L, Dong Z, Liang J, et al. As an independent prognostic factor, FAT10 promotes hepatitis B virus-related hepatocellular carcinoma progression via Akt/GSK3beta pathway. Oncogene. 2014;33:909–920. 21. Garrett CR, Coppola D, Wenham RM, et al. Phase I pharmacokinetic and pharmacodynamic study of triciribine phosphate monohydrate, a small-molecule inhibitor of AKT phosphorylation, in adult subjects with solid tumors containing activated AKT. Invest New Drugs. 2011;29:1381–1389. 22. Zhang H, Li Y, Lai M. The microRNA network and tumor metastasis. Oncogene. 2010;29:937–948. 23. Berridge MJ, Bootman MD, Roderick HL. Calcium signalling: dynamics, homeostasis and remodelling. Nat Rev Mol Cell Biol. 2003;4:517–529.

123

24. Chiu WT, Tang MJ, Jao HC, Shen MR. Soft substrate up-regulates the interaction of STIM1 with store-operated Ca2? channels that lead to normal epithelial cell apoptosis. Mol Biol Cell. 2008;19:2220–2230. 25. Carnero A. The PKB/AKT pathway in cancer. Curr Pharm Des. 2010;16:34–44. 26. Jayadev S, Petranka JG, Cheran SK, Biermann JA, Barrett JC, Murphy E. Reduced capacitative calcium entry correlates with vesicle accumulation and apoptosis. J Biol Chem. 1999;274: 8261–8268. 27. Parekh AB, Putney JW Jr. Store-operated calcium channels. Physiol Rev. 2005;85:757–810. 28. Zanotto-Filho A, Braganhol E, Schroder R, et al. NFkappaB inhibitors induce cell death in glioblastomas. Biochem Pharmacol. 2011;81:412–424. 29. Makeyev EV, Maniatis T. Multilevel regulation of gene expression by microRNAs. Science (New York, N.Y.). 2008;319: 1789–1790. 30. Yanaihara N, Caplen N, Bowman E, et al. Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell. 2006;9:189–198. 31. Alvarez-Garcia I, Miska EA. MicroRNA functions in animal development and human disease. Development (Cambridge, England). 2005;132:4653–4662. 32. Krutzfeldt J, Rajewsky N, Braich R, et al. Silencing of microRNAs in vivo with ‘antagomirs’. Nature. 2005;438:685–689. 33. Abdelmohsen K, Srikantan S, Kuwano Y, Gorospe M. miR-519 reduces cell proliferation by lowering RNA-binding protein HuR levels. Proc Natl Acad Sci USA. 2008;105:20297–20302.