Arch Virol DOI 10.1007/s00705-014-2034-2

ORIGINAL ARTICLE

Helicoverpa armigera nucleopolyhedrovirus orf81 is a late gene involved in budded virus production Xiao-Feng Li • Huan Yu • Chuan-Xi Zhang Hui Chen • Dun Wang

•

Received: 26 June 2013 / Accepted: 22 February 2014 Ó Springer-Verlag Wien 2014

Abstract Helicoverpa armigera nucleopolyhedrovirus (HearNPV) orf81 (ha81) is a core gene that is highly conserved in all lepidopteran baculoviruses. Its homolog in the group I baculoviruses, ac93, has been shown to be essential for the nuclear egress of nucleocapsids, but its role in the group II HearNPV life cycle remains unknown. In this study, an ha81 mutant bacmid was constructed by homologous recombination to investigate the role of HA81 in the viral life cycle. Quantitative PCR analysis showed that viral DNA replication was unaffected in the absence of ha81. However, the budded virus production of the ha81null virus was completely blocked. Transmission electron microscopic analysis showed that ha81 is required for the egress of nucleocapsids from the nucleus. Analysis of the time course of transcription and expression revealed that ha81 is a late gene. An immunofluorescence analysis showed that the protein mainly localizes in the cytoplasm. To understand whether the transcription of other genes is affected by the deletion of ha81, the transcription of several well-characterized viral genes was investigated in the ha81-knockout HearNPV mutant. No obvious changes were observed at the transcription level, except for the odve25 gene downstream from ha81. In conclusion, these data indicate that ha81 is a late gene that is critical for budded

X.-F. Li  H. Yu  H. Chen  D. Wang (&) State Key Laboratory of Crop Stress Biology for Arid Areas, Northwest A&F University, Yangling, Shaanxi 712100, People’s Republic of China e-mail: [email protected]; [email protected] X.-F. Li  C.-X. Zhang Institute of Insect Science, Zhejiang University, Yuhangtang Road 866#, Hangzhou 310058, People’s Republic of China

virus production but is involved in neither viral DNA replication nor gene transcription.

Introduction Members of the Baculoviridae, a diverse family of more than 600 viruses, predominantly infect insects of the orders Lepidoptera, Hymenoptera, and Diptera. This family includes four genera: Alphabaculovirus, Betabaculovirus, Gammabaculovirus, and Deltabaculovirus [1]. The genus Alphabaculovirus is further subdivided into group I and group II based on phylogenetic analysis [2]. Helicoverpa armigera nucleopolyhedrovirus (HearNPV), a member of the genus Alphabaculovirus, was first isolated in 1975 in Hubei, China. To date, three HearNPV genomes (C1, G4, and NNg1) have been sequenced [3–5]. The HearNPV G4 strain, the most intensively studied member of the group II alphabaculoviruses [2, 6], contains a genome of 131,403 bp, encoding 135 putative open reading frames (ORFs) [5]. Since the HaBacHZ8 bacmid was constructed [7], the functions of many HearNPV genes have been determined, including those of ha33 (bv-e31) [8, 9], ha53 (fp25k) [10], ha83 [11], ha85 (pif-4) [12], and ha132 (pif-2) [13]. HearNPV orf81 (ha81) is one of the 37 genes present in all of the sequenced baculovirus genomes [14] that have been identified as the baculovirus core genes. Among these core genes, three core gene clusters have been identified [15–17], the relative positions of which are conserved in all baculovirus genomes. This indicates that there may be some physical restraint preventing them, or at least their DNA sequences, from being separated [18]. p33, ha81, and odv-e25 are highly conserved in the baculoviruses and constitute a core gene cluster. Previous studies have shown that all of these genes play very important roles in the virus

123

X.-F. Li et al.

life cycle [15, 19, 20], but whether the whole cluster has any other function remains unknown. The ha81 gene has a typical late gene promoter motif, ATAAG, about 129 nt upstream from the translation start codon. Analysis using the InterProScan program revealed that ha81 shares 31 %–70 % amino acid sequence identity with its homologs in baculoviruses, and these homologs constitute the DUF682 baculovirus protein family, the functions of which are unknown. Its homolog AC93 has been identified as a structural component of both the budded virus (BV) and occlusion-derived virus (ODV) and is essential for the nuclear egress of nucleocapsids in group I Autographa californica multiple nucleopolyhedrovirus (AcMNPV) [15]. However, the group II baculovirus protein HA81 shares only 49 % amino acid sequence homology with AC93. Therefore, the potentially vital role that HA81 plays in the HearNPV life cycle remains unclear. In this study, the transcription and expression patterns of ha81 and the localization of HA81 in virus-infected HzAM1 cells were examined. To clarify the function of HearNPV orf81, ha81-knockout and repaired bacmids were generated to investigate the role of HA81 in viral growth and DNA replication. Real-time PCR was performed to determine the role of HA81 in viral transcription.

Materials and methods Viruses and cells HzAM1 cells were maintained in Grace’s insect medium supplemented with 10 % fetal bovine serum (Gibco/BRL, USA) at 28 °C. The HearNPV virus G4 strain [21] was propagated in HzAM1 cells. An infectious HearNPV recombinant bacmid, HaBacHZ8, maintained in Escherichia coli strain BW25113, was used as the bacmid source. Preparation of polyclonal antiserum The ha81 coding region was amplified from the HearNPV (G4 strain) genomic DNA by PCR with primers ha81-F and ha81-R (Table 1) and subcloned into the expression vector pET-32a. The HA81 fusion protein with a 69 His tag was expressed in E. coli DE3 induced with 1 mM isopropyl b-D-1-thiogalactopyranoside (IPTG) at 37 °C, and the 69 His-tagged recombinant HA81 protein was purified on an Ni2?-NTA column (Novagen, GER). The purified protein in complete Freund’s adjuvant (Sigma, USA) was injected subcutaneously to immunize New Zealand white rabbits. This was followed by two booster injections in incomplete Freund’s adjuvant at two-week

123

intervals before exsanguination. The prepared polyclonal rabbit antiserum directed against HA81 was used for the immunoassays. Analysis of ha81 transcription in HzAM1 cells HzAM1 cells (2 9 106) were infected with HearNPV at a multiplicity of infection (MOI) of 5, or cells were mock infected. Total RNA was isolated from the virus-infected cells and mock-infected cells at 3, 6, 12, 24, 48, 72, and 96 hours postinfection (hpi) using RNAiso Plus (TaKaRa, JPN) according to the manufacturer’s protocol. After the RNA samples were treated with RNase-free DNase I (TaKaRa, JPN), the first-strand cDNA was synthesized using a PrimeScript RT-PCR Kit (TaKaRa, JPN), with incubation at 37 °C for 15 min and 85 °C for 5 s. The subsequent PCR was performed with 40 cycles of 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 10 s. The primers used were the ha81-specific primers T-81F and T-81R, the ie1-specific primers ie1-F and ie1-R, and the gapdh-specific primers gapdh-F and gapdh-R (Table 1). The PCR products were then analyzed on a 1.0 % agarose gel. To map the transcription stop sites for ha81, the total RNA was extracted from HearNPV-infected cells with RNAiso Plus (TaKaRa, JPN) according to the manufacturer’s protocol. Briefly, the first-strand cDNA was synthesized from 1.0 lg of total RNA (as template) with M-MLV reverse transcriptase (Tiangen, CHN) and an oligo(dT) anchor primer. The cDNA was amplified using an outer primer and the ha81-specific primer T81-F. The PCR products were purified and ligated into the pMD-19T vector (TaKaRa, JPN) and sequenced to determine the 30 end of the ha81 transcript. Analysis of ha81 expression in HzAM1 cells HzAM1 cells (2 9 106) were infected with HearNPV at an MOI of 5; uninfected cells were used as the control. At the indicated time points (3, 6, 12, 24, 48, 72, and 96 hpi), the cells were washed three times with phosphate-buffered saline (PBS) and collected by centrifugation at 20009g for 5 min. The proteins were then separated by 10 % SDSPAGE and transferred electrophoretically to a nitrocellulose membrane. Immunoblotting was performed using standard protocols. The primary antibodies used included a monoclonal anti-actin antibody (1:10,000) and a polyclonal anti-HA81 antiserum (1:256,000). The secondary antibodies used were horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (1:10,000) and HRP-conjugated goat anti-rabbit IgG (1:10,000). The proteins were visualized with an enhanced chemiluminescence system (ECL; BioRad), according to the manufacturer’s instructions.

Helicoverpa armigera nucleopolyhedrovirus orf81 Table 1 Primer sequences used in this study Application

Primer name

Primer sequence (50 –30 )

Amplification of Cmr and egfp with HearNPV ha81 flanking sequences

HaD81F

50 AAGTTTAGTTTCTTTTCGGAACTCAAAAAGGAGGAGGCCTTATTTATGAAAAAGTAACTCGAGAAATTTCTCTGGCCG 30 (homologous arm of ha81)

HaD81R

50 AATATGTACGCGACGAATTGTTCGCAATATGTCAATATACTTTTACCGAAAGCCAAGCTTTTTAAGGGCACCAATA 30 (homologous arm of ha81)

Id81Fin

50 GTTCTATTGGACGCGCTCAT 30

Id81Fout

50 GAGCAACAAGACGAACGCAC 30

Id81-R

50 GCTGCTTTGGCCTGACGAATCG 30

Identification of transposition

M13-F M13-R

50 CCCAGTCACGACGTTGTAAAACG 30 50 AGCGGATAACAATTTCACACAGG 30

Time course of ha81

T81-F

50 CCTCGTCACAGGAGCAACA 30

T81-R

50 TCACAAGTCTCGTCCAACA 30

polh-F

50 GGATCCATGTATACTCGTTACAGT 30 (BamHI)

Identification of ha81 knockout bacmid

polh coding sequence

polh-R

50 CTGCAGTTAATATGCAGGACCAGT 30 (PstI)

polh with its promoter and SV40 polyA signal

phS-F

50 TGATCAAATATGAAGATTTCTGTCGTCGTGTTG 30 (BclI)

phS-R

50 TGATCA GATCCAGACATGATAAGATACATTGATG 30 (BclI)

Amplification of complete ha81

ha81-F

5 0 CGGATCCATGACCTCGTCACAGGAGCAA 30 (BamHI)

ha81-R

50 GCTCGAGCTCAAACAATTTGTATGACA 30 (XhoI)

egfp-F

50 TGATCACTCGAGAAATTTCTCTGGC 30 (BclI)

egfp-R

50 TGATCA ATCTGAACTTGTTTATTGC 30 (BclI)

gp41-F

50 AGCATAATCATTTGCGGTGTT 30

gp41-R

50 TCTAGTTCGGACGCTTGGA 30

gapdhF

50 GGTGCCCAGCAGAACATC 30

gapdhR

50 GGAAAGCCATACCAGTCAG 30

ie1-F

50 AGATCCGAAAGGTCAGAAA 30

ie1-R

50 TTACCATAAAGTCCGCTAC 30

e56–F

50 GGTCGCAGTCTTGTCGTG 30

e56-R

50 AAGCCTCTTTATAGCTGTTCGT 30

p33 specific

p33-F

50 GCGGCAACGACAGTAACCATT 30

p33-R

50 CTTGATACGTTCGTCGCCCTC 30

odv-e25 specific

e25-F e25-R

50 CCACCGCAAATAGGGTCACAG 30 50 TACCATGCCGTCGGATTCATA 30

lef-4 specific

lef-4-F

50 CATTCATCCGTTGTTAGCG 30

lef-4-R

50 CCACGTATGCCGTCCAATT 30

q81-F

50 AAGTATATTGACATATTGCG 30

q81-R

50 TGACAGACAGTTGCAGTAA 30

egfp specific gp41 specific for replication gapdh used as a reference gene

ie-1 specific odv-e56 specific

ha81 specific for transcription analysis

Construction of ha81-knockout HearNPV bacmid ha81 was deleted from a HearNPV bacmid (HaBacHZ8) using the method reported by Datsenko [22]. First, the linear fragment containing the homologous ha81 arms was amplified with primers HaD81-F and HaD81-R (Table 1), using the pKS-egfp-Cmr vector (pKSE) as template, and the resulting linear 2.2-kbp fragment containing a chloramphenicol resistance gene (Cmr) cassette with its own

promoter and terminator, an enhanced green fluorescent protein gene (egfp) cassette with an hsp70 promoter and SV40 terminator, and the ha81-flanking regions was gel purified and resuspended in distilled water. Escherichia coli BW25113 cells containing the HaBacHZ8 DNA and pKD46 plasmid were then transformed with the linear fragment. Positive clones of the ha81 mutant HaBacHZ8 bacmid, in which a 108-bp coding sequence of ha81 (nt 74481–74588 in the HearNPV-G4 genome) was replaced

123

X.-F. Li et al.

with Cmr and egfp, were selected by their chloramphenicol resistance and confirmed by PCR. The resulting recombinant bacmid was designated HaBacD81. Construction of knockout, repaired, and wild-type HearNPV bacmids with the polyhedrin gene To insert the polyhedrin gene (polh) into the HaBacHZ8 and HaBacD81 bacmids, a donor plasmid containing polh was constructed. Initially, plasmid pFastBac HTb was digested with BamHI and Bst1107I to remove the polh gene promoter of AcMNPV, and then a synthesized HearNPV polh promoter (160 bp) with Bst1107I and BamHI sites at opposite ends was cloned into pFastBac HTb. The resulting construct was designated HTb-hap. The coding region of the polh gene, amplified from HearNPVG4 with primers polh-F and polh-R (Table 1), was digested with BamHI and PstI and inserted into HTb-hap, generating the donor plasmid HTb-polh. Electrocompetent E. coli BW25113 cells containing the pMON7124 helper plasmid and HaBacD81 were then transformed with HTb-polh to generate the ha81 knockout bacmid (HaBacD81-PG). To confirm that the traits of the ha81 knockout were attributable to the deletion of ha81, an ha81-repaired bacmid (HaBacRep81-PG) was constructed. First, ha81 with its native promoter region was amplified from HearNPV-G4 with primers ha81-F and ha81-R (Table 1). This fragment was introduced into the corresponding restriction sites of HTb to generate HTb-ha81. Another fragment containing the coding region of the polh gene with its own promoter and the SV40 poly(A) signal was amplified with primers phS-F and phS-R (Table 1), using HTb-polh as the template. The PCR product was digested with BclI and inserted into the BclI site in HTb-ha81. The resulting plasmid was designated HTb-ha81-polh. Finally, ha81 and polh contained in HTb-ha81-polh were introduced into the polh locus of HaBacD81 by transposition as described above. As the positive control bacmid, HaBacHZ8-PG containing egfp was also constructed. An egfp cassette was amplified from the pKSE vector using primers egfp-F and egfp-R (Table 1). The cassette was inserted into the BclI site of HTb-polh to generate HTb-polh-egfp. Competent E. coli BW25113 cells containing the pMON7124 helper plasmid and HaBacHZ8 were then transformed with the donor vector, HTb-polh-egfp, to generate the wild-type bacmid. Analysis of the viral growth curve HzAM1 cells (2 9 106) were transfected with 2.0 lg of HaBac-PG, HaBacD81-PG, and HaBacRep81-PG bacmid DNA. The virus supernatant was collected at 6, 12, 24, 48,

123

72, 96 and 120 hours posttransfection (hpt). The titers of BV were determined using a tissue-culture infective dose (TCID50) end-point dilution assay of the HzAM1 cells. Each viral transfection was performed in triplicate. Viral infection was confirmed by monitoring egfp expression by fluorescence microscopy. qPCR analysis of DNA replication HzAM1 cells were transfected as described above, and the cells were harvested at the indicated time points. Total DNA was extracted at 6, 12, 24, 48, 72, and 96 hpt, using a Universal Genomic DNA Extraction Kit (TaKaRa, JPN) according to the manufacturer’s protocol. DNA from uninfected HzAM1 cells was used as a control. Each viral transfection was performed in triplicate. The total DNA was diluted to a total volume of 30 ll with sterile water, and 10 ll of total DNA from each time point was digested with 25 U of DpnI (TaKaRa, JPN) in a 50-ll total reaction volume to eliminate the input bacmid before the PCR analysis. The qPCR was then performed with 40 cycles of 94 °C for 30 s, 56 °C for 10 s, and 72 °C for 60 s. The gp41 primers gp41-F and gp41-R (Table 1) were used for the analysis of viral DNA replication. A standard curve was created with a dilution series of the recombinant plasmid (pGEM-T-gp41). Five dilutions (each 1:10) were prepared to cover the workable concentrations of the DNA templates. Transmission electron microscopy (TEM) HzAM1 cells (2 9 106) were transfected with 2.0 lg of HaBacHZ8-PG and HaBacD81-PG. At 24 hpt, the cells were dislodged with a rubber policeman and centrifuged at 20009g for 10 min. The cells were then fixed, dehydrated, embedded, sectioned, and stained as described previously [23]. The samples were visualized with a Hitachi H-9500 transmission electron microscope at an accelerating voltage of 80 kV. qPCR analysis of HearNPV transcription To further examine the effects of ha81 knockout, transcripts from several well-characterized genes were analyzed. Briefly, 2 9 106 HzAM1 cells were transfected with 2.0 lg of HaBacHZ8-PG and HaBacD81-PG. Total RNA was isolated from transfected-cells at 6 and 24 hpt. cDNA was synthesized as described above. As target genes, we selected ie-1 and lef-4 as representative early genes, and odv-e56 and gp41 as representative late genes. Transcription of ha81 and its adjacent genes (p33, odv-e25) were also measured. qPCR was then performed as described above, using the primers listed in Table 1.

Helicoverpa armigera nucleopolyhedrovirus orf81

Fig. 1 Transcription and expression analysis of ha81 in HearNPVinfected HzAM1 cells. (a) Transcription analysis of ha81 in HearNPV-infected HzAM1 cells. Total RNA was extracted from HearNPV-infected HzAM1 cells at 3, 6, 12, 24, 48, 72 and 96 hpi or mock-infected cells. RT-PCR was performed, and the amplification products were subsequently analyzed electrophoresis in a 1.0 % agarose gel. ie1 is a positive control for early genes, and gapdh is a internal loading control. (b) Immunoblot analysis of HA81 in HearNPV-infected HzAM1 cells. HzAM1 cells were infected with HearNPV at an MOI of 5. Protein samples were harvested from 3 to 96 hpi, separated by 10 % SDS-PAGE, transferred onto a nitrocellulose membrane and reacted with anti-HA81 polyclonal antiserum. Uninfected cells and actin were used as controls. The signal was visualized using an enhanced chemiluminescence system

Immunofluorescence microscopy HzAM1 cells (2 9 106) were infected with HearNPV at an MOI of 5. At 48 hpi, the supernatant was removed, and the cells were washed three times in PBS and then fixed in 4 % paraformaldehyde in PBS for 30 min. The fixed cells were then washed three times in PBS for 5 min before they were permeabilized in 0.1 % Triton X-100 in PBS for 15 min. The cells were then blocked for 1 h in blocking buffer (10 % bovine serum albumin in PBS) and incubated for 2 h with rabbit polyclonal anti-HA81 antiserum (1:256,000). The cells were washed three times for 5 min in blocking buffer and incubated for 1 h with rhodamine (TRITC)conjugated goat anti-rabbit IgG (H?L) antibody (1:100). The cells were then washed three times with PBS for 5 min, stained with 4,6-diamidino-2-phenylindole (DAPI) (Sigma, USA) at a concentration of 200 ng/ml, and examined under a Nikon A1 confocal microscope.

Results Transcription and expression analyses of ha81 A late transcription initiation motif, ATAAG, was found 129 nt upstream from the ATG translation start codon of ha81, suggesting that ha81 is a late gene. To investigate the temporal transcription of ha81, reverse transcription PCR

analysis was performed with total RNA purified from mock-infected and HearNPV-infected HzAM1 cells at various time points after infection. A single band (149 bp) of ha81-specific product was detected at 12–96 hpi. In contrast, the ie-1 fragment (104 bp) was detectable at 3–96 hpi (Fig. 1). No signal was amplified from the RNA isolated from mock-infected HzAM1 cells. These results suggest that HearNPV ha81 is transcribed as a late gene. ha81 encodes a protein of approximately 19.1 kDa. A protein band of about 19 kDa was detected at 12–96 hpi by immunoblot analysis (Fig. 1), which is consistent with our prediction. No specific immunoreactive band was detected from the mock-infected control cells. This result confirms that ha81 is a late gene, supporting the results of the transcription analysis. Construction and infection of recombinant HearNPV viruses The ha81-null bacmid HaBacD81 was generated by homologous recombination to determine whether ha81 is essential for viral replication. To avoid affecting the transcription of the adjacent genes p33 and odv-e25, 203 bp of the 50 end and 178 bp of the 30 end of ha81 were retained, and a 108-bp fragment of the ha81 coding region (nt 74481–74588) was replaced with Cmr and egfp by homologous recombination (Fig. 2a), which was confirmed by PCR (data not shown). To examine the effects of the ha81 deletion on the virus, the polh gene with its own promoter was transposed into the polh locus of HaBacD81 to generate HaBacD81-PG. A ha81-repaired bacmid, HaBacRep81-PG, which contained the ha81 ORF driven by its native promoter and polh with its own promoter, was constructed to determine whether the phenotype resulting from the ha81 knockout was attributable to genomic effects. HaBacHZ8PG, a positive control bacmid, was also generated by introducing the polh gene and egfp gene into the polh locus of HaBacHZ8 by transposition. These three bacmids were confirmed by PCR using M13F/R primers (data not shown). Deletion of ha81 does not affect viral DNA replication but blocks BV production To determine whether the defective ha81 affected viral replication, HzAM1 cells were transfected with HaBacHZ8-PG, HaBacD81-PG, or HaBacRep81-PG bacmid, and the expression of egfp and polh were monitored by fluorescence microscopy. No significant differences in fluorescence were observed among these three viruses at 24 hpt. However, fluorescence was observed in almost 80 % of the HaBacHZ8-PG- and HaBacRep81-PG-transfected cells by 72 hpt, (Fig. 3a), indicating that the ha81repaired bacmid could generate infectious BV after the

123

X.-F. Li et al.

Fig. 2 Construction of the HaBacHZ8-PG, HaBacD81-PG, and HaBacRep81-PG bacmids. The ha81 ORF was inactivated by insertion of the Cmr cassette (with its own promoter and terminator) and the egfp cassette (with an hsp70 promoter and SV40 terminator) between nt 74,481 and 74,588 of the HearNPV-G4 genome (NC_002654.2) via homologous recombination in E. coli

BW25113. Sequences of 203 bp at the 50 end and 178 bp at the 30 end of ha81 were retained. The lower part of the figure shows the genes inserted into the polh locus by Tn7-mediated transposition to generate HaBacHZ8-PG, HaBacD81-PG, and HaBacRep81-PG bacmids

Fig. 3 Analysis of viral replication in HzAM1 cells. (a) Microscopy analysis. Fluorescence microscopy shows the progression of viral infection in HzAM1 cells transfected with HaBacHZ8-PG, HaBacD81-PG, and HaBacRep81-PG bacmids from 24 to 72 hpi. Light microscopy shows the formation of occlusion bodies in HaBacHZ8PG-, HaBacD81-PG-, and HaBacRep81-PG bacmid-transfected cells at 72 hpi. (b) One-step growth curves of the recombinant viruses.

HzAM1 cells were transfected with 2.0 lg of bacmid DNA from each virus. Cells culture supernatants were harvested at the selected time points, and BV titers at various times postinfection were determined by TCID50 assay. Each datum represents the average value from three independent transfections titrated in triplicate. Error bars represent standard errors

initial transfection. In contrast, HaBacD81-PG-transfected cells showed almost no detectable increase in the number of infected cells (Fig. 3a), suggesting that there was no spread of the virus beyond the cells initially transfected with the ha81-knockout bacmid DNA. Normal-appearing occlusion bodies (OBs) were formed in these three viruses

at 72 hpt (Fig. 3a). Nevertheless, the HaBacD81-PGtransfected cells that contained OBs were restricted to the initially transfected cells (Fig. 3a), whereas almost 80 % of the HaBacHZ8-PG- and HaBacRep81-PG-transfected cells contained OBs, indicating the generation of BV and the spread of infection.

123

Helicoverpa armigera nucleopolyhedrovirus orf81

Fig. 4 qPCR analysis of viral DNA replication. HzAM1 cells were transfected with 2.0 lg of HaBacHZ8-PG, HaBacD81-PG, and HaBacRep81-PG bacmid DNA. At the designated time points, total cellular DNA was extracted and analyzed by qPCR. The values represent results of three replication assays. Each sample was performed in triplicate; error bars represent standard deviation

To determine the effects of ha81 knockout on BV production, viral growth curves were analyzed (Fig. 3b). HzAM1 cells were transfected with the HaBacHZ8-PG, HaBacD81-PG, or HaBacRep81-PG bacmid, and the BV titers were determined by TCID50 endpoint dilution assay at selected time points. The supernatants from HzAM1 cells transfected with the HaBacRep81-PG bacmid showed a steady increase in BV production, with a pattern similar to that of the HaBacHZ8-PG virus. In contrast, no virus was detected in the supernatants from the HaBacD81-PGtransfected cells, suggesting that ha81 is essential for HearNPV viral replication. Because the defect could be rescued by the HaBacRep81-PG bacmid, a genomic effect at the site of the ha81 deletion can be excluded. Hence, these results suggest that the deletion of ha81 causes a defect in infectious BV production. To determine whether the lack of BV production in cells transfected with the HaBacD81-PG bacmid was attributable to a defect in viral DNA replication, a qPCR analysis was performed to compare the viral DNA replication levels in the HaBacHZ8-PG-, HaBacD81-PG-, and HaBacRep81-PGtransfected cells. Viral DNA replication was initiated at the same time in the three viruses, from 0 to 12 hpt, and showed similar patterns of increase by 24 hpt (Fig. 4). However, the viral DNA levels differed greatly between the HaBacD81PG- and HaBacRep81-PG-transfected cells and between the HaBacD81-PG- and HaBacHZ8-PG-transfected cells at 24–96 hpt (Fig. 4), which could be attributable to secondary infections in the HaBacHZ8-PG- and HaBacRep81-PGtransfected cells, whereas the viral DNA replication of vHaBacD81-PG was restricted to the initially transfected

Fig. 5 Electron microscopic analysis. HzAM1 cells were transfected with HaBacD81-PG (b, d) and HaBacRep81-PG (a, c) bacmid, fixed at 24 hpt, and processed for observation. (a) Electron-dense nucleocapsids in the virogenic stroma (VS) of cells transfected with HaBacRep81-PG bacmid. (b) Normal apperance nucleocapsids in the VS. (c) Nucleocapsids (white arrows) budding through the nuclear membrane (Nm) or in the cytoplasm. (d) A portion of a cell showing a lack of nucleocapsids residing in the cytoplasm or budding at the nuclear membrane. VS, virogenic stroma; Nu, nucleus; Nm, nuclear membrane. Scale bar, 500 nm

cells. Consequently, qPCR analysis showed that ha81 is not required for viral DNA replication in HzAM1 cells. TEM analysis of transfected cells A TEM analysis was performed with thin sections of HaBacD81-PG- and HaBacRep81-PG-transfected HzAM1 cells to analyze the effects of ha81 deletion on viral morphogenesis. Typical sections were chosen and analyzed. At 24 hpt, typical virogenic stroma (VS) and a large number of rod-shaped nucleocapsids appeared in the nuclei of the HaBacRep81-PGbacmid-transfected cells (Fig. 5a), with nucleocapsids budding through the nuclear membrane and in the cytoplasm (Fig. 5c). In contrast, although typical VS and abundant normal-appearing nucleocapsids (Fig. 5b) were observed in the nuclei of cells transfected with the bacmid HaBacD81-PG (Fig. 5b) at 24 hpt, no nucleocapsids were found in the cytoplasm or budding through the cytoplasmic membrane (Fig. 5d). These observations indicate that the deletion of ha81 affects the egress of the nucleocapsid from the nucleus. Quantification of transcripts from selected viral genes by qPCR To analyze the effects of the ha81 knockout, we examined the mRNA accumulation of several well-characterized

123

X.-F. Li et al. Fig. 6 Quantification of transcripts from selected viral genes by qPCR. (a) ie-1, (b) lef4, (c) odv-e56, (d) gp41, (e) p33, (f) odv-e25, For each graph, the vertical axis indicates the relative amount of RNA estimated in comparison to 1.0 lg of RNA purified from infected HzAM1 cells. Transfections were performed in triplicate with 2.0 lg of HaBacHZ8-PG or HaBacD81PG, and RNA was purified at 6 and 24 hpi. Average qPCR data were derived from nine data measurements for each time point posttransfection. Error bars represent the standard deviation. Statistically significant differences between the ha81 knockout and control viruses are indicated by asterisks (*P \ 0.05)

genes. As the target genes, we selected ie-1 and lef-4 as representative early genes, and odv-e56 and gp41 as representative late genes. The qPCR analysis showed that the ie-1 and lef-4 transcripts were either unaffected or even perhaps slightly increased at 6 hpt when ha81 was deleted (Fig. 6a, b). The late genes odv-e56 and gp41 were also unaffected in the late stage of infection when ha81 was deleted (Fig. 6c, d). Therefore, overall, we detected no substantial changes in the expression of the early (ie-1 and lef-4) or late genes (odv-e56 and gp41) in the absence of ha81. To further examine the effects of ha81 knockout on the core gene cluster, we examined the accumulation of the mRNAs of genes in the cluster. A qPCR analysis showed that the transcription of p33 was unaffected by the ha81 knockout in the early and late stages of infection (Fig. 6e), but the transcription of odv-e25 was reduced by approximately 28 % relative to that in the HaBacHZ8-PG-transfected cells at 24 hpt (Fig. 6f). In addition, no signal was detected for ha81 transcription (data not shown), indicating that ha81 was completely disrupted by the insertion inactivation. We detected no significant difference in transcription in the absence of ha81, except for odv-e25. To understand why the transcription of odv-e25 was affected by the ha81

123

deletion, a 30 random amplification of cDNA ends (RACE) of ha81 was performed. The 30 RACE produced two major bands specific to the virus-infected cells by 24 hpi. Sequencing these two bands showed two different transcription stop sites, located 129 and 756 nt downstream from the ha81 translation stop codon, TGA (Fig. 7a, c). The first stop site (?618 nt [Fig. 7b]) was 15 nt downstream from a canonical poly(A) signal sequence, AATAAA, and the second site (?1245 nt [Fig. 7b]), 17 nt downstream from another AATAAA in which the TAA is the stop codon of odv-e25. Therefore, the reduction in odve25 transcripts probably arose from the disruption of the long transcript of ha81 (Fig. 7c), while odv-e25 could be driven by its own promoter in cells transfected with HaBacD81-PG. Subcellular localization of HA81 during infection The subcellular localization of HA81 was determined by immunofluorescence microscopy. Cells infected with HearNPV were fixed, and their immunofluorescence was analyzed using an antibody directed against HA81. At 48 hpi, the negative control, uninfected HzAM1 cells, displayed no detectable fluorescence, and HA81 appeared to be localized mainly in the cytoplasm (Fig. 8).

Helicoverpa armigera nucleopolyhedrovirus orf81 Fig. 7 30 RACE analysis of the ha81 transcriptional stop site. (a) Schematic diagram showing the location of potential transcription stop sites and the location of the transcribed ha81 transcripts (arrows). (b) Agarose gel analysis of ha81 30 RACE products at 24 hpi. Sizes of products are shown on the left. (c) Sequences of the 30 RACE products and the HearNPV genome sequence. The canonical polyadenylation signal (AATAAA) is shaded, and the ha81 and odv-e25 stop codons are underlined. The ha81 gene was found to have two different transcripts: a short transcript and a long transcript

Fig. 8 Localization of HA81 determined by immunofluorescence. HzAM1 cells were infected with HearNPV at an MOI of 5. At 48 hpi, cells were fixed, probed with anti-HA81 polyclonal antiserum to detect HA81, and visualized using a rhodamine (TRITC)-conjugated goat antirabbit IgG (red) antibody. Additionally, HzAM1 cells were stained with DAPI to directly visualize nuclear DNA (blue). Healthy HzAM1 cells were used as a negative control (colour figure online)

Discussion ha81 is one of the 37 baculovirus core genes that are highly conserved in all baculovirus genomes sequenced so far [14]. Almost all core genes have been shown to encode critical functions in the baculovirus life cycle. In the

current study, ha81 was identified as an essential gene. BV production was completely blocked in cells transfected with HaBacD81-PG, whereas normal-appearing OBs were formed. Viral DNA replication appeared to be unaffected, indicating that ha81 is not required for viral DNA replication. Together, these observations suggest that ha81 has

123

X.-F. Li et al.

a role in facilitating the events after viral DNA replication, such as the efficient transport of nucleocapsids from the nucleus to the cytoplasm, or viral budding from the cell. This hypothesis was confirmed by a TEM analysis, which showed that the deletion of ha81 affected the egress of nucleocapsids from the nucleus. Electron microscopy also showed that the nuclei of cells transfected with HaBacD81-PG produced normal-length nucleocapsids with an electron-dense nucleoprotein core, indicating that the deletion of ha81 had no effect on nucleocapsid assembly. The normal appearance of these nucleocapsids suggests that the newly replicated viral genomes had been packaged into capsids. This is consistent with the analysis of viral DNA replication, which showed that ha81 is not involved in viral DNA synthesis. The TEM results showed that ha81 is required for the egress of nucleocapsids from the nucleus to the cytoplasm, which explains why BV production was completely blocked. Previous studies have shown that the deletion of 38k [17], ac109 [24], exon0 [25], odv-e25 [19] or p48 [26] causes a defect in BV production but that viral DNA replication remains unaffected. Although these mutants share similar characteristics, the specific functions of each gene in the process of BV production may differ. For example, 38k is required for nucleocapsid assembly; exon0 is required for the efficient egress of the nucleocapsids from the nucleus; and the deletion of ac109 results in noninfectious BV. Until now, the precise mechanism of nucleocapsid entry into the cytoplasm from the nucleus in baculovirus infection has been unclear, although it has been shown that nucleocapsids acquire a double-membraned vesicle derived from the nuclear membrane when exiting through the nuclear membrane [27]. In the present study, no vesicles were formed in the nuclear membranes of cells transfected with HaBacD81-PG, so it is possible that ha81 is involved in vesicle formation. Previous studies have shown that the three contiguous genes p33, ac93, and odv-e25 are highly conserved in the baculoviruses [15] and constitute the third core gene cluster identified to date. However, the derivation of the core gene clusters and why they occur in all baculoviruses are unclear. Studies of varicella-zoster virus (VZV) have shown that the gene cluster (orf9–orf12) encodes four tegument proteins that are highly conserved in the alphaherpesviruses. The individual genes within the orf9–orf12 gene cluster, except orf9, are not essential and can be deleted synchronously without any obvious effect on VZV replication in vitro, whereas the orf10–orf12 cluster is critical for VZV virulence in the skin in vivo [28]. Previous studies of AcMNPV revealed that the homologs of these three genes are all associated with both BV and ODV, and that they are all critical for BV production [15, 19, 20], suggesting a crucial role for this core gene cluster in the

123

life cycle of the virus. Because the core gene cluster is evolutionarily conserved in the baculoviruses, HearNPV might have the same function. Surprisingly, studies of HearNPV have shown that this core gene cluster does not share all of those properties: P33 is associated with ODV, whereas in a proteomic analysis, HA81 was detected only in BV [29]. A possible reason is that the homologous regions have distinctly low amino acid sequence identities between group II and group I. An alternative explanation is that HA81 is a minor component of the ODV, below the level of detection. Although we cannot determine the specific functions of the core gene cluster, it might play a major role in BV production and virus formation. Previous studies have led to the conclusion that each core gene cluster in the baculoviruses might be part of a single transcriptional unit or part of a spliced transcript [30]. However, the transcription direction of p33 is opposite that of the other two genes, so they might not be in a transcriptional unit. Although our results showed that the accumulation of odv-e25 mRNA was reduced in the absence of ha81, the transcript of ha81 was not detected in HaBacD81-PG-transfected HzAM1 cells, while the odve25 was detected. This indicates that ha81 and odv-e25 probably have their own promoters, which is consistent with previous studies on AcMNPV [19, 31] and SpltNPV [32]. Clusters of tightly arranged genes with the same transcriptional orientation are common in baculovirus genomes [33]. Several studies have shown that transcription of the upstream gene may interfere with the transcription of the downstream gene via a regulatory mechanism known as ‘‘promoter occlusion’’ [34–36]. It was still unknown whether ha81 and odv-e25 were affected by this regulatory mechanism, and further precise work needs to be done to determine whether the core gene cluster in baculoviruses is in a single transcriptional unit. The deletion of ha81 did not affect virus replication, as demonstrated in this study. However, whether ha81 is involved in the transcription of viral genes remains unclear. It is known that baculovirus early promoters are recognized by the host RNA polymerase II and that they resemble host RNA polymerase II promoters [37]. Both ie-1 and lef-4 are principal transcriptional regulators in baculoviruses [38, 39]. Here, we have shown that ie-1 and lef-4 transcripts were either unaffected or even slightly increased when ha81 was deleted, so it is possible that ha81 did not regulate gene expression through the early genes involved in transcription. Late promoters are always transcribed by a virus-specific late RNA polymerase, and they differ from the early promoters [40]. The two late genes we investigated, odv-e56 [41, 42] and gp41 [43, 44], were both unaffected by the deletion of ha81. Taken together, these data suggest that ha81 might not be involved in the viral transcription process.

Helicoverpa armigera nucleopolyhedrovirus orf81

In conclusion, this study has shown that ha81 is an essential late gene required for the egress of nucleocapsids from the nucleus and subsequent BV production. Although the exact role of HA81 is unclear, we hope that the results of our study will lead to a better understanding of the mechanism of nucleocapsid transport. Additional studies are required to evaluate the function of HA81 and the products of the core gene cluster in the viral infection process. Acknowledgments The authors thank Dr. Zhihong Hu, Wuhan Institute of Virology, CAS, for generously providing HaBacHZ8, PKD46 plasmid, and pKSE plasmid. This work was supported by the National Natural Science Foundation of China (No: 31270691, 31170609) and Program for Changjiang Scholars and Innovative Research Team in University (IRT1035).

References 1. King AM, Adams MJ, Lefkowitz EJ, Carstens EB (2011) Virus taxonomy: IXth report of the International Committee on taxonomy of viruses, vol 9. Access Online via Elsevier 2. Herniou EA, Luque T, Chen X, Vlak JM, Winstanley D, Cory JS, O’Reilly DR (2001) Use of whole genome sequence data to infer baculovirus phylogeny. J Virol 75(17):8117–8126 3. Ogembo JG, Caoili BL, Shikata M, Chaeychomsri S, Kobayashi M, Ikeda M (2009) Comparative genomic sequence analysis of novel Helicoverpa armigera nucleopolyhedrovirus (NPV) isolated from Kenya and three other previously sequenced Helicoverpa spp. NPVs. Virus Genes 39(2):261–272 4. Zhang CX, Ma XC, Guo ZJ (2005) Comparison of the complete genome sequence between C1 and G4 isolates of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus. Virology 333(1):190–199. doi:10.1016/j.virol.2004.12.028 5. Chen X, IJkel WF, Tarchini R, Sun X, Sandbrink H, Wang H, Peters S, Zuidema D, Lankhorst RK, Vlak JM, Hu Z (2001) The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome. J Gen Virol 82(Pt 1):241–257 6. Bulach DM, Kumar CA, Zaia A, Liang B, Tribe DE (1999) Group II nucleopolyhedrovirus subgroups revealed by phylogenetic analysis of polyhedrin and DNA polymerase gene sequences. J Invertebr Pathol 73(1):59–73. doi:10.1006/jipa.1998.4797 7. Wang H, Deng F, Pijlman GP, Chen X, Sun X, Vlak JM, Hu Z (2003) Cloning of biologically active genomes from a Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus isolate by using a bacterial artificial chromosome. Virus Res 97(2):57–63. doi:10.1016/j.virusres.2003.07.001 8. Wang D, Yan XC, Shyam K, Guo ZJ, Zhang CX (2006) Bacterial expression and cellular localization of Helicoverpa armigera nucleopolyhedrovirus Orf33 in infected host cells. Acta Microbiol Sinica 46(1):60–62 9. Wang D, An SH, Guo ZJ, Xu HJ, Zhang CX (2005) Characterization of Helicoverpa armigera nucleopolyhedrovirus orf33 that encodes a novel budded virion derived protein, BV-e31. Arch Virol 150(8):1505–1515. doi:10.1007/s00705-005-0534-9 10. Wu D, Deng F, Sun X, Wang H, Yuan L, Vlak JM, Hu Z (2005) Functional analysis of FP25K of Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus. J Gen Virol 86(Pt 9):2439–2444. doi:10.1099/vir.0.81110-0 11. Wang D, Zhang CX (2006) HearSNPV orf83 encodes a late, nonstructural protein with an active chitin-binding domain. Virus Res 117(2):237–243. doi:10.1016/j.virusres.2005.10.019

12. Huang H, Wang M, Deng F, Wang H, Hu Z (2012) ORF85 of HearNPV encodes the per os infectivity factor 4 (PIF4) and is essential for the formation of the PIF complex. Virology 427(2):217–223. doi:10.1016/j.virol.2012.01.022 13. Fang M, Nie Y, Wang Q, Deng F, Wang R, Wang H, Vlak JM, Chen X, Hu Z (2006) Open reading frame 132 of Heliocoverpa armigera nucleopolyhedrovirus encodes a functional per os infectivity factor (PIF-2). J Gen Virol 87(9):2563–2569 14. Garavaglia MJ, Miele SA, Iserte JA, Belaich MN, Ghiringhelli PD (2012) The ac53, ac78, ac101, and ac103 genes are newly discovered core genes in the family Baculoviridae. J Virol 86(22):12069–12079. doi:10.1128/JVI.01873-12 15. Yuan M, Huang Z, Wei D, Hu Z, Yang K, Pang Y (2011) Identification of Autographa californica nucleopolyhedrovirus ac93 as a core gene and its requirement for intranuclear microvesicle formation and nuclear egress of nucleocapsids. J Virol 85(22):11664–11674. doi:10.1128/JVI.05275-11 16. McCarthy CB, Theilmann DA (2008) AcMNPV ac143 (odv-e18) is essential for mediating budded virus production and is the 30th baculovirus core gene. Virology 375(1):277–291. doi:10.1016/j. virol.2008.01.039 17. Wu W, Lin T, Pan L, Yu M, Li Z, Pang Y, Yang K (2006) Autographa californica multiple nucleopolyhedrovirus nucleocapsid assembly is interrupted upon deletion of the 38K gene. J Virol 80(23):11475–11485. doi:10.1128/JVI.01155-06 18. Ma XC, Xu HJ, Tang MJ, Xiao Q, Hong J, Zhang CX (2006) Morphological, phylogenetic and biological characteristics of Ectropis obliqua single-nucleocapsid nucleopolyhedrovirus. J Microbiol 44(1):77–82 19. Chen L, Hu X, Xiang X, Yu S, Yang R, Wu X (2012) Autographa californica multiple nucleopolyhedrovirus odv-e25 (Ac94) is required for budded virus infectivity and occlusion-derived virus formation. Arch Virol 157(4):617–625. doi:10.1007/s00705-0111211-9 20. Wu W, Passarelli AL (2010) Autographa californica multiple nucleopolyhedrovirus Ac92 (ORF92, P33) is required for budded virus production and multiply enveloped occlusion-derived virus formation. J Virol 84(23):12351–12361. doi:10.1128/JVI.0159810 21. Sun XL, Zhang GY, Zhang ZX, Hu ZH, Vlak JM, Arif BM (1998) In vivo cloning of Helicoverpa armigera single nucleocapsid nuclear polyhedrosis virus genotypes. Virol Sinica 13(1):83–88 22. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97(12):6640–6645. doi:10.1073/ pnas.120163297 23. Xu HJ, Yang ZN, Zhao JF, Tian CH, Ge JQ, Tang XD, Bao YY, Zhang CX (2008) Bombyx mori nucleopolyhedrovirus ORF56 encodes an occlusion-derived virus protein and is not essential for budded virus production. J Gen Virol 89(Pt 5):1212–1219. doi:10.1099/vir.0.83633-0 24. Fang M, Nie Y, Theilmann DA (2009) Deletion of the AcMNPV core gene ac109 results in budded virions that are non-infectious. Virology 389(1–2):66–74. doi:10.1016/j.virol.2009.04.003 25. Fang M, Nie Y, Theilmann DA (2009) AcMNPV EXON0 (AC141) which is required for the efficient egress of budded virus nucleocapsids interacts with beta-tubulin. Virology 385(2):496–504. doi:10.1016/j.virol.2008.12.023 26. Yuan M, Wu W, Liu C, Wang Y, Hu Z, Yang K, Pang Y (2008) A highly conserved baculovirus gene p48 (ac103) is essential for BV production and ODV envelopment. Virology 379(1):87–96. doi:10.1016/j.virol.2008.06.015 27. Faulkner P, Kuzio J, Williams GV, Wilson JA (1997) Analysis of p74, a PDV envelope protein of Autographa californica nucleopolyhedrovirus required for occlusion body infectivity in vivo. J Gen Virol 78(Pt 12):3091–3100

123

X.-F. Li et al. 28. Che X, Reichelt M, Sommer MH, Rajamani J, Zerboni L, Arvin AM (2008) Functions of the ORF9-to-ORF12 gene cluster in varicella-zoster virus replication and in the pathogenesis of skin infection. J Virol 82(12):5825–5834. doi:10.1128/JVI.00303-08 29. Hou D, Zhang L, Deng F, Fang W, Wang R, Liu X, Guo L, Rayner S, Chen X, Wang H, Hu Z (2013) Comparative Proteomics reveal fundamental structural and functional differences between the two progeny phenotypes of a baculovirus. J Virol 87(2):829–839. doi:10.1128/JVI.02329-12 30. Herniou EA, Olszewski JA, Cory JS, O’Reilly DR (2003) The genome sequence and evolution of baculoviruses. Annu Rev Entomol 48:211–234. doi:10.1146/annurev.ento.48.091801.112756 31. Chen YR, Zhong S, Fei Z, Hashimoto Y, Xiang JZ, Zhang S, Blissard GW (2013) The transcriptome of the baculovirus Autographa californica multiple nucleopolyhedrovirus in Trichoplusia ni cells. J Virol 87(11):6391–6405. doi:10.1128/JVI. 00194-13 32. Li Z, Pan L, Yu H, Li S, Zhang G, Pang Y (2006) Identification and characterization of odv-e25 of Spodoptera litura multicapsid nucleopolyhedrovirus. Virus Genes 32(1):13–19. doi:10.1007/ s11262-005-5840-5 33. Hu Z, Yuan M, Wu W, Liu C, Yang K, Pang Y (2010) Autographa californica multiple nucleopolyhedrovirus ac76 is involved in intranuclear microvesicle formation. J Virol 84(15):7437–7447. doi:10.1128/JVI.02103-09 34. Gutierrez S, Kikhno I, Lopez Ferber M (2004) Transcription and promoter analysis of pif, an essential but low-expressed baculovirus gene. J Gen Virol 85(Pt 2):331–341 35. Acharya A, Gopinathan K (2002) Transcriptional analysis and preliminary characterization of ORF Bm42 from Bombyx mori nucleopolyhedrovirus. Virology 299(2):213–224 36. Gross CH, Rohrmann GF (1993) Analysis of the role of 50 promoter elements and 30 flanking sequences on the expression of a

123

37.

38.

39.

40.

41.

42.

43. 44.

baculovirus polyhedron envelope protein gene. Virology 192(1):273–281. doi:10.1006/viro.1993.1030 Huh NE, Weaver RF (1990) Identifying the RNA polymerases that synthesize specific transcripts of the Autographa californica nuclear polyhedrosis virus. J Gen Virol 71:195–201 Schultz KL, Wetter JA, Fiore DC, Friesen PD (2009) Transactivator IE1 is required for baculovirus early replication events that trigger apoptosis in permissive and nonpermissive cells. J Virol 83(1):262–272. doi:10.1128/JVI.01827-08 Li Y, Guarino LA (2008) Roles of LEF-4 and PTP/BVP RNA triphosphatases in processing of baculovirus late mRNAs. J Virol 82(11):5573–5583. doi:10.1128/JVI.00058-08 Guarino LA, Xu B, Jin J, Dong W (1998) A virus-encoded RNA polymerase purified from baculovirus-infected cells. J Virol 72(10):7985–7991 Sparks WO, Harrison RL, Bonning BC (2011) Autographa californica multiple nucleopolyhedrovirus ODV-E56 is a per os infectivity factor, but is not essential for binding and fusion of occlusion-derived virus to the host midgut. Virology 409(1):69–76. doi:10.1016/j.virol.2010.09.027 Braunagel SC, Elton DM, Ma H, Summers MD (1996) Identification and analysis of an Autographa californica nuclear polyhedrosis virus structural protein of the occlusion-derived virus envelope: ODV-E56. Virology 217(1):97–110. doi:10.1006/viro. 1996.0097 Olszewski J, Miller LK (1997) A role for baculovirus GP41 in budded virus production. Virology 233(2):292–301 Whitford M, Faulkner P (1992) Nucleotide sequence and transcriptional analysis of a gene encoding gp41, a structural glycoprotein of the baculovirus Autographa californica nuclear polyhedrosis virus. J Virol 66(8):4763–4768