In Vitro Cell.Dev.Biol.—Animal DOI 10.1007/s11626-013-9729-7
Immunophenotypic characterization and tenogenic differentiation of mesenchymal stromal cells isolated from equine umbilical cord blood Niharika Mohanty & Baldev R. Gulati & Rajesh Kumar & Sandeep Gera & Pawan Kumar & Rajesh K. Somasundaram & Sandeep Kumar
Received: 17 September 2013 / Accepted: 22 December 2013 / Editor: T. Okamoto # The Society for In Vitro Biology 2014
Abstract Mesenchymal stem cells (MSCs) isolated from umbilical cord blood (UCB) in equines have not been well characterized with respect to the expression of pluripotency and mesenchymal markers and for tenogenic differentiation potential in vitro. The plastic adherent fibroblast-like cells isolated from 13 out of 20 UCB samples could proliferate till passage 20. The cells expressed pluripotency markers (OCT4, NANOG, and SOX2) and MSC surface markers (CD90, CD73, and CD105) by RT-PCR, but did not express CD34, CD45, and CD14. On immunocytochemistry, the isolated cells showed expression of CD90 and CD73 proteins, but tested negative for CD34 and CD45. In flow cytometry, CD29, CD44, CD73, and CD90 were expressed by 96.36 ± 1.28%, 93.40 ± 0.70%, 73.23 ± 1.29% and 46.75 ± 3.95% cells, respectively. The UCB-MSCs could be differentiated to tenocytes by culturing in growth medium supplemented with 50 ng/ml of BMP-12 by day 10. The differentiated cells N. Mohanty : S. Gera : S. Kumar Department of Veterinary Physiology and Biochemistry, College of Veterinary Sciences, LLR University of Veterinary & Animal Sciences, Hisar 25004, Haryana, India B. R. Gulati (*) : R. Kumar National Research Centre on Equines, Sirsa Road, Hisar 125001, Haryana, India e-mail:
[email protected] P. Kumar Department of Veterinary Anatomy, College of Veterinary Sciences, LLR University of Veterinary & Animal Sciences, Hisar 125004, Haryana, India R. K. Somasundaram Equine Breeding Stud, Hisar 125001, Haryana, India
showed the expression of mohawk homeobox (Mkx), collagen type I alpha 1 (Col1α1), scleraxis (Scx), tenomodulin (Tnmd) and decorin (Dcn) by RT-PCR. In addition, flow cytometry detected tenomodulin and decorin protein in 95.65±2.15% and 96.30±1.00% of differentiated cells in comparison to 11.30±0.10% and 19.45±0.55% cells, respectively in undifferentiated control cells. The findings support the observation that these cells may be suitable for therapeutic applications, including ruptured tendons in racehorses. Keywords Umbilical cord blood . Horse mesenchymal stromal cell . Pluripotency . Tenogenic differentiation
Introduction Mesenchymal stem cells (MSCs) are the preferred source of biological therapeutic adult stem cells in equine tissue engineering and regenerative medicine (Koch et al. 2009; Borjesson and Peroni 2011). Horse as a high performance athlete is especially prone to tendon and cartilage injuries, in which traditional treatment methods decrease their performance post healing due to scar formation. Stem cell therapy utilizing mesenchymal stem cells for the treatment of equine tendinopathies is gradually turning into clinical routine (Brehm et al. 2012). Equine MSCs have been isolated from different postnatal tissues including, bone marrow (BM) (Vidal et al. 2008; Violini et al. 2009; Godwin et al. 2011), adipose tissue (AT) (de Mattos et al. 2009; Braun et al. 2010; Raabe et al. 2013), and peripheral blood (PB) (Dhar et al. 2012). However, enthusiasm for the use of adult MSCs as
MOHANTY ET AL.
cytotherapeutics from these established sources is limited by their age-dependent decline in absolute numbers and the invasive nature of their harvest (Stenderup et al. 2003). Equine fetal adnexa, such as umbilical cord matrix (Hoynowski et al. 2007; Lovati et al. 2011), umbilical cord blood (Koch et al. 2007; Reed and Johnson 2008; Schuh et al. 2009), amnion (Lange-Consiglio et al. 2012), placenta (Carrade et al. 2011a), and amniotic fluid (Lovati et al. 2011) are considered alternative and preferred sources of MSCs due to non-invasive nature of the isolation procedures (Cremonesi et al. 2011). MSCs isolated from UCB are considered more progenitor with regard to delayed senescence, immune tolerance, proliferative potential and differentiation potency (Carrade et al. 2011b) and their characteristics fall between pluripotent embryonic stem cell and multipotent adult MSCs (Reed and Johnson 2008). UCB-derived MSCs migrate faster indicating that their graft integration in vivo might be better than that of BM-derived MSC (Burk et al. 2013). UCB is an established non-invasive source of hematopoietic stem cells (Kakinuma et al. 2003) and MSCs (Sibov et al. 2012) in human medicine for treatment of tendon injuries in athletes (Romanov et al. 2003). It is also recommended that before use of stem cells for musculoskeletal injuries in human, efficacy and safety studies should be done in rat and horses (Borjesson and Peroni 2011). The horse is an accepted experimental model due to its similarity in bone structure and remodeling pattern to that of humans. MSCs need to be fully characterized with respect to their stemness, proliferation, and differentiation potential before exploited for therapeutic use (Tarnok et al. 2010; Zhang and Chan 2010). Clinical application of equine UCB-MSCs requires the identification of suitable markers that would indicate the differentiation status of these cells under specific conditions as in case of human UCB-MSCs (Sibov et al. 2012). An important feature to identify MSCs is expression of a set of cell surface markers such as CD29, CD44, CD73, CD90, and CD105, and the absence of markers which are mainly present on leukocytes and hematopoietic stem cells, i.e., CD34, CD45, CD11b or CD14, CD19 or CD79α and MHC II (Dominici et al. 2006; De Schauwer et al. 2011). But the unequivocal characterization of equine MSCs is hampered by the limited availability of monoclonal antibodies (mAbs) directed against equine epitopes or antibodies showing cross-reactivity with the horse epitopes. This was supported in a study of Ibrahim et al. (2007), where only 14 out of the 379 tested anti-human mAbs, i.e. less than 5%, recognized the corresponding epitopes on isolated equine leukocytes. However, using RT-PCR and flow cytometry with cross-reactive antibodies, the expression of some of these cell surface MSCs markers has been observed in equine MSCs (Radcliffe et al. 2010; Ranera et al. 2011; De Schauwer et al. 2012).
Oct4, Sox2, and Nanog are key regulators essential for the formation and/or maintenance and for self-renewal of pluripotent embryonic stem cells (Niwa et al. 2000; Avilion et al. 2003; Chambers et al. 2003). The expression of pluripotency transcription factors has been demonstrated in human MSCs (Tsai and Hung, 2012). In equines, umbilical cord-derived (Cremonesi et al. 2011) and bone marrow-derived MSCs (Violini et al. 2009) express pluripotency-related transcription factors. Although Reed and Johnson (2008) reported presence of Oct4 marker on UCB-derived equine MSCs, the expression of all these three pluripotency markers (Oct4, Nanog, and Sox2) in equine UCB-derived MSCs have not been reported. Several studies (Wang et al. 2005; Violini et al. 2009; Lee et al. 2011) have demonstrated differentiation of MSCs into tenocyte-like cells in response to chemical factors including bone morphogenetic proteins (BMPs), transforming growth factor-b (TGF-b) and fibroblast growth factor (FGF). BMPs, the members of the TGF-b/BMP super family with important regulatory roles in the development and morphogenesis of multiple organs and tissues (Sieber et al. 2009). Among these, BMP-12, the human homologue of mouse growth and differentiation factor 7 (GDF-7), has been shown to promote tendon differentiation of bone marrow-derived MSCs in equines in vitro (Violini et al. 2009). The in vitro differentiation of UCB-derived MSCs towards tenocytes has been recently reported by Burk et al. 2013, but the identification of differentiated tenocytes is not exploited much in UCB-MSCs. In this study, we evaluated the expression of mesenchymal and pluripotency markers by UCB-derived equine MSCs and their tenogenic differentiation. We also refined the methodology for identification of differentiated tenocytes.
Materials and Methods Unless otherwise specified, all the chemicals and cell culture media used for mesenchymal stem cell isolation and culture were procured from the Sigma Chemicals Co. (St. Louis, MO) and tissue culture flasks and dishes from Corning, Lowell, MA, USA. Collection of umbilical cord blood. Post-partum equine umbilical cord blood from thoroughbred mares (n=20) was collected before spontaneous breakage of umbilical cord from an organized farm near Hisar, Haryana, India. After clamping and disinfecting the umbilical cord with 70% alcohol, approximately 130–200 ml of umbilical cord blood (UCB) was collected via venipuncture using 2.5cm,16-gauge needle into a blood collection bag (HL Haemopack, India) containing citrate-phosphate dextroseadenine (CPDA) as the anticoagulant solution. The blood was then stored and transported at 4°C to the laboratory within 4 h.
TENOGENIC DIFFERENTIATION OF EQUINE UCB-MSCSS
consistency, low passage numbers (P3–P6) of actively growing cells were used further in all experiments.
Isolation and culture of MSCs. For mononuclear cell separation, each sample was diluted with equal volume of Dulbecco’s phosphate buffered saline (DPBS) containing 100 IU/ml penicillin and 100 mg/ml streptomycin. The sample was carefully overlayered on histopaque with equal volume in a centrifuge tube. It was then centrifuged at 450g for 20 min at 25°C. The inter-phase was collected and washed twice with DPBS at room temperature. The cells were then treated with RBC lysis buffer for 5 min at 4°C followed by washing with DPBS. The cells were suspended in 1 ml of mesenchymal stem cell growth medium containing lowglucose DMEM supplemented with 15% fetal bovine serum (FBS), MEM non-essential amino acid (1%), vitamin (1%), penicillin (100 IU/ml), streptomycin (0.1 mg/ml) and L-glutamine (2 mM). Live cells were counted by trypan blue dye (0.4%) exclusion method using hemocytometer and seeded at 105cells/cm2 in 25 cm2 tissue culture flasks. Incubation was done at 38.5°C in humidified atmosphere containing 5% CO2. The medium was changed after 24 h and thereafter every third day. The cell growth and morphology was observed under inverted microscope (IX51, Olympus, Tokyo, Japan). The cells were sub-cultured at 80–90% confluency. For
Colony forming unit (CFU) assay. UCB-MSCs from passage 1–8 were seeded in triplicate (300 cells/cm2) in the growth medium in 60-mm tissue culture dish and incubated for 5 days by incubating at 5% CO2 and 38.5°C. Cells were then fixed with methanol and stained with Giemsa stain. Colonies consisting of more than 16–20 nucleated cells were counted and data was reported as plating efficiency (PE %), calculated as number of colonies/number of seeded cells×100. Population doubling time (PDT). The proliferation capacity of UCB-MSCs was evaluated at passage P1 to P8 in triplicates from three different donors. In each passage, 5×103 cells/cm2 were seeded in 25 cm2 tissue culture flasks and incubated at 5% CO2, 90% humidity and at 38.5°C. At 80% confluency cells were trypsinized and the number of viable cells was counted by the trypan blue dye exclusion method. The population doubling time in hour (h) was calculated as reported (Vidal et al. 2007).
Table 1 Details of primers used for RT-PCR analysis Marker
Primer sequence (5′–3′)
Amplicon size (bp)
Annealing temp. (°C)
Accession no.
GAPDH
F: CAAGGTCATCCATGACAACTTTG R: GTCCACCACCCTGTTGCTGTAG F: AGAGGCAACCTGGAGAACATG R: GGGCAATGTGGCTGATCTG F: TACCTCAGCCTCCAGCAGAT R: CAGTTGTTTTTCTGCCACCT F: TGGTTACCTCTTCCTCCCACT R: GGGCAGTGTGCCGTTAAT F: TGCGAACTCCGCCTCTCT R: GCTTATGCCCTCGCACTTG F: GGGATTGTTGGATACACTTCAAAAG R: GCTGCAACGCAGTGATTTCA F: AAGAGCTCATCTCGAGTCTG R: ATGCTCAGGGATCATTGGGG F: CACTAAACCCTCTACATCATTTTCTCCTA R: GGCAGATACCTTGAGTCAATTTCA F: TGATTCCCAGAAATGACCATGTA R: ACATTTTGGGCTTGTCCTGTAAC F: TTGATCTCAGCTGCAACAGG R: CAGAGGGTCGGTTGGTTAAGAC F: AGTGGCTTTACAAGCACCGT R: ACACTAAGCCGCTCAGCATT F: CAAGAGGAGGGCCAAGAAGA R: TCCTGTGGTTTGGTCGTCTG F: TCTGCCTCAGCAACCAGAGA R: AAAGTTCCAGTGGGTCTGGG F: ACATGGAAATTGATCCCGTG R: GTCTTGTAACTCTGAAACTGC F: CTTGCACAAGTTTCCTGGGC R: CGCTTTTCGCACTTTGGTGA
496
58
NM_001163856.1
70
60
XM_001490108
119
58
XM_001498808
179
58
FJ356148.1
93
60
EU881920.1
90
60
XM 001500115.2
338
56
XM_003364145.1
101
60
XM 001491596
101
60
AY114350.1
303
56
NM_001081927.1
217
60
XM_001495736
261
60
AF034691
246
62
NM_001105150
362
58
NM_001081822.1
481
62
NM_001081925.1
Oct4 Nanog SOX2 CD90 CD73 CD105 CD34 CD45 CD14 Mkx Col1α1 Scx Tnmd Dcn
MOHANTY ET AL. Table 2 Antibodies used for immunocytochemistry and flow cytometry and their cross-reactivity Antibodies
Host, isotype
Epitope
Clone
Company
CD73 CD90 CD34
Mouse, IgG1, κ Mouse, IgG1, κ Mouse, IgG1, κ
Rat Human Human
5 F/B9 5E10 8G12
BD Biosciences BD Biosciences BD Biosciences
CD45
Mouse, IgG1, κ
Human
2D1
BD Biosciences
CD29-FITC CD44-FITC
Mouse, IgG1, κ Mouse, IgG2b, κ
Human Human
TS2/16 IM7
eBioscience eBioscience
CD90-PE CD73-FITC CD34-PE
Mouse, IgG1, κ Mouse, IgG1, κ Mouse, IgG1, κ
Human Human Human
5E10 AD2 8G12
BD Pharmigen BD Pharmigen BD Biosciences
CD45-FITC
Mouse, IgG1, κ
Human
2D1
BD Biosciences
Tenomodulin Decorin IgG/IgM-FITC IgG-FITC
Goat Goat Goat Donkey
Human Human Mouse Goat
Polyclonal Polyclonal Polyclonal Polyclonal
Santa Cruz Bio Santa Cruz Bio BD Biosciences Santa Cruz Bio
Cell cross-reactivity IHC
Flow cytometry
MSC + MSC + MSC− PBMC+ MSC− PBMC+ MSC+ MSC+
MSC + MSC + MSC− PBMC+ MSC− PBMC+ MSC+ MSC+
MSC+ MSC− MSC− PBMC+ MSC− PBMC+
MSC+ MSC− MSC− PBMC+ MSC− PBMC+
IHC immunohistochemistry, PBMC peripheral blood mononuclear cells (horse)
Reverse transcriptase-polymerase chain reaction. The expression of pluripotency marker genes (Oct4, Nanog, Sox-2) and mesenchymal cell surface marker genes (CD73, CD90, CD105) and hematopoeitic/leukocytic marker genes (CD14, CD34, and CD45) was assessed by reverse transcriptasepolymerase chain reaction (RT-PCR) in cultured UCBMSCs at passage 3. The RNA was isolated using RNeasy kit (Qiagen, Milan, Italy) as per manufacturer’s protocol. The quality and quantity of RNA was determined by A260/A280 using BioPhotometer plus (Eppendorf AG, Germany). The first-strand cDNA was synthesized by using RevertAid firststrand cDNA synthesis kit (Fermentas, USA) in a total of 20 μl reaction volume, using 1 μg RNA, 10 mM dNTPs, 0.2 μg oligo dT primers, 20 units of RiboLock RNase inhibitor, and 200 units of M-MuLV reverse transcriptase H. The
Fig. 1 Morphology of equine umbilical cord blood derived mesenchymal stem cells (a) Primary colony exhibiting a mesenchymal stem cells-like shape with a flat polygonal morphology. (b) Monolayer of rapidly expanding adherent spindle-shaped fibroblastoid cells at passage 2.
integrity of cDNA was assessed by amplification of a housekeeping gene GAPDH. The PCR amplification was done by using primers specific for each gene separately in a 25-μl volume (Table 1). The amplification reaction mixture consisted of 1× PCR buffer, 10 mM dNTP, 10 μM of each gene specific forward and reverse primers, 1 mM MgCl2, 5 U/μl Taq DNA polymerase, and 3 μl of cDNA. An initial 5-min denaturation step at 94°C was followed by 35 cycles including denaturation at 94°C for 30 s, annealing temperature as per Table 1 for 30 s and elongation at 72°C for 30 s followed by final elongation step at 72°C for 5 min. The amplified PCR products were resolved in 2% electrophoresis through agarose gel containing ethidium bromide and visualized in Syngene GBox gel documentation system (Cambridge, CB4 1TF, UK).
TENOGENIC DIFFERENTIATION OF EQUINE UCB-MSCSS Table 3 Population doubling time and plating efficiency of UCB-MSCs Passage number
Population doubling time (in h) Plating efficiency (%)
1 2 3 4
30.48±1.43 a 47.52±0.48 b 45.16±0.01 c 46.02±0.02 b, c
2.53±0.33 a 2.17±0.02 a 2.21±0.01 b 2.61±0.48 c
5 6 7 8 Mean
45.225±0.54 c 45.91±0.11 b, c 53.59±0.59 d 60.53±0.44 e 44.84±1.80
3.50±0.06 d 2.96±0.04 c 2.38±0.08 a 2.66±0.26 c 2.55±0.22
Data are presented as mean±standard error (SE) (p<0.05). Data with different superscripts differ significantly
Immunocytochemistry. Immunostaining was performed as described by Lovati et al. (2011), with some modifications using antibodies listed in Table 2. Briefly, UCB-MSCs at passage 4 were seeded at 5,000 cell/cm2 in four-well glass chamber slides (SPL biosciences Ltd., Pocheon, South Korea) and were incubated in 5% CO2 incubator at 38.5°C. After overnight incubation, cells were rinsed with rinse buffer (PBS with 0.2% BSA) followed by fixation with 4% paraformaldehyde for 20 min. Cell permeabilization was done with 0.1% triton-X 100 in PBS for 10 min followed by blocking in blocking buffer (3% FBS in PBS) for 30 min. After three washings, cells in triplicate were incubated with 1:50 dilution of antibodies against CD90, CD73, CD34, and CD45 for 1 h at 37°C. After three washings, cells were incubated with IgG/ IgM-FITC at 1:100 dilution in blocking buffer for 1 h at 37°C
Fig. 2 Expression of pluripotency and cell surface markers in equine UCB-MSCs at passage 2 by RT-PCR (a) Pluripotency marker expression Lanes 1 OCT4 (70 bp); 2 Nanog (119 bp); 3 SOX2 (179 bp); 4 50 bp ladder; 5 GAPDH (496 bp) as internal control; 6 Reverse Transcriptase
in dark. After three washings, cells were visualized under the fluorescent microscope (1X51, Olympus, Japan) using suitable filter. Fibroblast cells derived from ear pina of horse were used as negative control for CD73 and CD90 antibodies and adult horse peripheral blood mononuclear cells served as positive control for CD34 and CD45 antibodies. Flow cytometry. UCB-MSCs were trypsinized at passage 4 and re-suspended in culture medium at 10 6 cells/ml. Harvested cells were pelleted and fixed with 4% paraformaldehyde at 4°C followed by washing with washing buffer (0.2% BSA in PBS containing 0.01% sodium azide). Cells in triplicate tubes were incubated with 1:50 dilution of mouse anti-human CD29-FITC, CD44-FITC, CD73FITC, CD90-PE, CD45-FITC, and CD34-PE antibodies (Table 2) for 45 min in dark at room temperature. Cells were washed three times and re-suspended in washing buffer. For all tubes, at least 10,000 cells were analyzed using FACS Calibur (BD Biosciences, San Diego, CA). The data was analyzed with FACSDiva software (BD Biosciences). All data were corrected for non-specific binding using isotypematched negative controls. Tenogenic differentiation. At passages 3 and 5, UCB-MSCs were plated at density of 6×104 cells /cm2 for overnight attachment. To induce tenogenic differentiation, cell cultures were incubated in growth medium supplemented with different concentrations of BMP-12 (10, 25, and 50 ng/ml) and incubated for different time periods (7–28 days), with media change on every alternate day. The cells were stained by hematoxylin and eosin (H&E) for morphology study. RNA isolated from the differentiated cells was reverse-transcribed
control (b) Cell surface markers expression Lanes 1 CD34 (101 bp) 2 CD45 (101 bp); 3 CD14 (303 bp); 4 Reverse Transcriptase control; 5 GAPDH (496 bp); 6 50 bp ladder; 7 CD73 (91 bp); 8 CD90 (93 bp); 9 CD105 (338 bp) and 10 100 bp ladder.
MOHANTY ET AL. Fig. 3 Expression of cell surface markers in equine UCB-MSCs by immunostaining. The cells were stained with antibodies directed against CD73 (a) and CD90 (b) and visualized under phase contrast (upper panel) and under fluorescent microscope (lower panel).
and amplified by polymerase chain reaction with mohawk homeobox (Mkx), collagen type I alpha 1 (Col1α1), scleraxis (Scx), tenomodulin (Tnmd), and decorin (Dcn) specific primers (Table 1) and the amplified PCR products were visualized in 2% agarose gel by electrophoresis. The expression of tenomodulin and decorin was further confirmed by immunocytochemistry and flow cytometry. The undifferentiated MSCs served as negative control. For immunocytochemistry and flow cytometry, cells in triplicate were stained first with antibody to tenomodulin or decorin (Table 2) followed by staining with IgG-FITC (Table 2), following the protocol described in previous section. The MSCs without BMP-12 treatment served as negative control in immunocytochemistry and flow cytometry. Statistical analysis. Using the SPSS 17.0 software (IBM, New York, NY, Windows Version), population doubling time, plating efficiency and flow cytometry data were analyzed by one-way ANOVA using Duncan’s multiple range test (DMRT) at 0.05% level of significance.
Results UCB collection. The UCB was collected from 20 thoroughbred mares during full term foaling. No complications for both mares and foals were encountered upon umbilical cord blood sampling at delivery. The sample storage and transport temperature was 4°C, transport time was 2–6 h (mean 4.0 h). The volume of UCB samples ranged from 130 to 200 ml (mean 165 ml). Isolation and proliferation of MSCs. The mononuclear cells (1×105cells/cm2) in 25 cm2 culture flasks were seeded for isolation of MSCs. The adherent colonies growing in a monolayer were observed in 13 out of 20 UCB samples, giving an isolation success rate of 65%. The spindle-shaped colonies were observed as early as 6 d post-seeding (range 6–20 d) and 70–80% confluency was reached by day 30 post-seeding. The isolated cells presented heterogeneous morphology but on subculture, there was predominance of fibroblastoid cells (Fig. 1). Starting from passage 2, the UCB-MSCs formed a
Fig. 4 Flow cytometry analysis of equine UCB-MSCs for expression of surface markers. Plot showing unstained cells (a); markers CD73 and CD90 (b) CD29 and CD90 (c); CD44 and CD90 (d); and CD34 and CD45 (e).
TENOGENIC DIFFERENTIATION OF EQUINE UCB-MSCSS
morphologically homogeneous population of fibroblast-like cells, which could be sub-cultured till 20 passages, after which the cells exhibited growth arrest. The UCB-MSCs had a mean population doubling (PD) time of 44.84±1.80 h and plating efficiency of 2.55±0.22% during initial 8 passages (Table 3). Before growth arrest, the morphology of these cells changed from fibroblastoid to irregular shape with increased cell size, decreased proliferation rate, increased passage time, and finally stopped dividing. MSC characterization. The UCB-MSCs at passage 3 expressed Oct4, Nanog, Sox-2 (pluripotency markers) and CD90, CD73 and CD105 (mesenchymal markers) by RTPCR, but did not express CD34, CD45, and CD14 (hematopoetic and leukocytic markers) (Fig. 2). GAPDH was used as internal positive control for RNA. Immunocytochemical analysis results indicated that UCBMSCs expressed CD73 and CD90 (MSC markers) but fibroblast cells from ear pina of horse did not express these markers. UCB-MSCs did not express hematopoietic/ leukocytic marker, viz. CD34 and CD45 (Fig. 3). Flow cytometry of UCB-derived horse MSCs showed expression of CD29 and CD44 by 96.36±1.28% and 93.4±0.70% cells while CD73 and CD90 were expressed by 73.23±1.29% and 46.75±3.95% cells, respectively. Reactivity against the hematopoietic antigens CD45 and CD34 was observed in less than 3% (2.4±0.20%) cells (Fig. 4), while 98.46±1.45% unstained cells did not show any fluorescence. Tenogenic differentiation. Cultures of UCB-MSCs did not show any change in the morphology of cells on supplementation of 10 and 25 ng/ml of BMP-12 in the growth medium till day 28. However, growth medium supplemented with 50 ng/ml of BMP-12 induced tenocytic differentiation by day 10, as exhibited by morphological changes. The BMP12 treated cells appeared slender, elongated, spindle shaped with thinner and longer cytoplasmic processes as compared to untreated cells (Fig. 5). The BMP-12 treated cells showed the expression of Mkx, Col1α1, Scx, Tnmd, and Dcn genes by RT-PCR, while untreated control cells did not express these genes (Fig. 6). Immunocytochemical analysis indicated that Fig. 5 Tenogenic differentiation of equine UCB-MSCs (H&E staining). A colony of MSCs after 10 days of culture in presence of BMP-12 (a) and undifferentiated cells in absence of BMP-12 (b).
Fig. 6 RT-PCR analysis of equine UCB-MSCs before and after tenogenic differentiation. Col1α1 (261 bp), Mkx (217 bp), Scx (246 bp), Tnmd (362 bp), and Dcn (481 bp) were expressed by differentiated equine UCB (lanes 4, 6, 8, 10, 12) but not by undifferentiated control cells (lanes 3, 5, 7, 9, 11), respectively; Lane 1 non-template control; Lane 2 GAPDH (496 bp) expression by undifferentiated cells; and Lane 13 100 bp ladder.
BMP-12 treated cells were positive for tenomodulin and decorin proteins compared to untreated cells (Fig. 7). In flow cytometry, BMP-12 treated cells showed expression of tenomodulin and decorin in 95.65±2.15% and 96.30±1.00% cells in comparison to 11.30±0.10% and 19.45±0.55% cells, respectively in untreated control cells (Fig. 8).
Discussion MSCs recovered from fetal adnexa have attracted considerable interest in recent years as a potential therapeutic tool in equine tendon and cartilage injuries (Cremonesi et al. 2011). Equine umbilical cord blood (UCB) MSCs have been reported to differentiate into chondrocytes, adipocytes, osteocytes, (Koch et al. 2007; Shuh et al. 2009; Iacono et al. 2012) and even myocytes and hepatocytes (Reed and Johnson 2008). UCB-derived MSCs express pluripotency markers (Hoynowski et al. 2007; Reed and Johnson
MOHANTY ET AL. Fig. 7 Immunostaining of equine UCB-MSCs after tenogenic differentiation. Differentiation induced (upper panel) cells showed immunoreactivity with antibodies directed against tenomodulin (a) and decorin (b). Undifferentiated MSCs did not show immunoreactivity with respective antibodies (Lower panel).
2008) and provide a pool of more primitive progenitor cells with broader differentiation capacities (Moretti et al. 2010). The purpose of this study was to reflect upon characterization of UCB-derived equine MSCs and their tenogenic differentiation in vitro. We reported the MSCs isolation frequency of 65%, which is more than reported by Koch et al. (2007) but less than reported by De Schauwer et al. (2012). The population doubling time of UCB-MSCs (44.84±1.80 h) in the present study was lower than that of data reported by Iacono et al. (2012). Plating efficiency of equine UCB-MSCs in this study was found to be 2.55±0.22% during initial eight passages, indicating their high clonogenicity, in comparison to those reported for MSCs isolated from amniotic fluid (AF), umbilical cord matrix (UCM) and bone marrow (BM) in earlier reports (Lovati et al. 2011). The UCB-derived MSCs in the present study showed expression of Oct4, Nanog and Sox-2 genes by RT-PCR. On the contrary, Nanog and Sox2 expression was not observed in UCB-MSCs in previous study (Reed and Johnson 2008). In the present study, we demonstrated that UCB-MSC express
CD73, CD90 and CD105 but they lacked the expression of CD34, CD45, and CD14 by RT-PCR. Similar gene expression results for CD73, CD90, CD105, and CD45 have been reported in adipose tissue (AT) MSCs and bone marrow (BM) MSCs (Ranera et al. 2011). However, some studies have reported the expression CD34 by equine MSCs (Ranera et al. 2011; Lange-Consiglio et al. 2012). The findings of gene expression studies were further confirmed by demonstration of proteins on cell surfaces by immunocytochemistry and flow cytometry. In flow cytometry, CD29, CD44, CD73, and CD90 were expressed by 96.36± 1.28%, 93.4±0.70%, 73.23±1.29% and 46.75±3.95% UCBMSCs, respectively. UCB-MSCs have been reported previously to express CD29, CD44, and CD90 (De Schauwer et al. 2012), however, UCB-MSCs in their study did not express CD73. This might be due to fact that the CD73 clones used by De Schauwer (AD2, 7G2, 4G4 and 496406) do not cross-react with equine CD73. In our study also, clone AD2 did not react with equine MSCs, while 73.23 ±1.29% of UCB-MSCs expressed CD73 with clone 5 F/B9. Therefore, a set of cross-reactive clones as identified in this study and by De
Fig. 8 Flow cytometry analysis of equine UCB-MSCs after tenogenic differentiation. Approximately 97.6% cells stained with antibodies to tenomodulin (a) and 91.9% of cells stained with antibodies to decorin (b) exhibited fluorescence. Only 11.4% of untreated control cells showed fluorescence (c).
TENOGENIC DIFFERENTIATION OF EQUINE UCB-MSCSS
Schuawer et al. (2012) may be employed for unequivocal characterization of equine MSCs till specific markers for equines are established. We observed that equine UCB-MSCs could be differentiated to tenocytes by day 10 following supplementation of BMP-12 (50 ng/ml) in the MSC growth medium in comparison to reported differentiation of equine bone marrowderived MSCs by day 14–21 (Violini et al. 2009). The supplementation of 10 ng/ml BMP-12 induced tenogenic differentiation in rat MSCs (Lee et al. 2011), however, 10 or 25 ng/ml dose did not induce tenogenic differentiation in equine UCB-MSCs till day 28 in our study. Not only the induction of tenogenic differentiation is challenging, but verification of this process is also complex, as there seems to be no clear demarcation between mature tenocytes and fibroblasts (Burk et al. 2013). The transmembrane protein tenomodulin is expressed by mature tenocytes and has been implicated in regulating their proliferation and matrix organization (Docheva et al. 2005). Decorin is a small cellular matrix proteoglycan, which regulates assembly of collagen fibrils and acquisition of biomechanical properties during tendon development (Zhang et al. 2006). Col1α1 is a main extracellular matrix component of tendon and Scx controls tenocyte differentiation by regulating the mRNA expression of type I collagen (Léjard et al. 2007). Scx is a basic helixloop-helix transcription factor expressed in the tendon progenitors and cells of all tendon tissues (Schweitzer et al. 2001). Scx is essential for tendon differentiation. Mkx is essential for a large set of developmental processes, including cell proliferation, differentiation, positional specification, and tendon and ligament development (Ito et al. 2010). In our study, BMP-12 treated MSCs expressed two tendon-specific markers (tenomodulin and decorin) as observed by immunocytochemistry, flow cytometry, and RT-PCR. The expression of tenomodulin and decorin was observed in 95.65±2.15% and 96.3±1.00% of differentiated cells compared to 11.3± 0.10% and 19.30±0.6% cells, respectively in untreated control cells. The differentiated UCB-derived MSCs also expressed Col1α1, Mkx, and Scx, as observed by RT-PCR. This is the first report of the flow-cytometric analysis of the expression of tenomodulin and decorin proteins in differentiated equine tenocytes. The expression of tenomodulin and decorin is consistent with progressive differentiation of these cells along tenocytic pathways evidenced by overall cellular organization, i.e. elongation and increasing side-by-side alignment similar to the tendon-like tissues (Wolfman et al. 1997). Similar morphology and expression of tenomodulin and decorin was reported by Violini et al. (2009) in horse bone marrow-derived MSCs when exposed to BMP-12. In conclusion, our study has demonstrated that equine UCB-MSCs express both pluripotency and mesenchymal stem cell markers. On treatment with BMP-12, these MSCs express high levels of tendon-specific genes, confirming their
differentiation into tenocytes and thus represent as a suitable candidate for cellular therapy in equine tendon injuries. Acknowledgments The authors wish to thank Remount Veterinary Services and Equine Breeding Stud, Hisar, Haryana, India for providing access for sampling. We thank NRCE, Hisar for infrastructure support. Financial support to Niharika from Indian Council of Agricultural Research (ICAR) and to Baldev R Gulati from Department of Biotechnology, Government of India is duly acknowledged. The assistance in flow cytometry by BD-FACS academy, New Delhi is duly acknowledged. Conflict of interest None of the authors of this paper has a financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of the paper.
References Avilion A. A.; Nicolis S. K.; Pevny L. H.; Perez L.; Vivian N.; LovellBadge R. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 17: 126–140; 2003. Borjesson D. L.; Peroni J. F. The regenerative medicine laboratory: facilitating stem cell therapy for equine disease. Clin. Lab. Med. 31: 109–123; 2011. Braun J.; Hack A.; WeisKlemm M.; Conrad S.; Treml S.; Kohler K.; Walliser U.; Skutella T.; Aicher W. K. Evaluation of the osteogenic and chondrogenic differentiation of capacities of equine adipose tissue derived mesenchymal stem cells. Am. J. Vet. Res. 71: 1228– 1236; 2010. Brehm W.; Burk J.; Delling U.; Gittel C. Ribitsch I Stem cell-based tissue engineering in veterinary orthopaedics. Cell Tissue Res. 347: 677– 688; 2012. Burk J.; Ribitsch I.; Gittel C.; Juelke H.; Kasper C.; Staszyk C.; Brehm W. Growth and differentiation characteristics of equine mesenchymal stromal cells derived from different sources. Vet. J. 195: 98–106; 2013. Carrade D. D.; Affolter V. K.; Outerbridge C. A.; Walson J. L.; Galuppo L. D.; Buerchler S.; Kumar V.; Walker N. J.; Borjesson D. L. Intradermal injections of equine allogeneic umbilical cord-derived mesenchymal stem cells are well tolerated and do not elicit immediate or delayed hypersensitivity reactions. Cytotherapy 13: 1180– 1192; 2011a. Carrade D. D.; Owens S. D.; Galuppo L. D.; Vidal M. A.; Ferraro G. L.; Librach F.; Buerchler S.; Friedman M. S.; Walker N. J.; Borjesson D. L. Clinicopathologic findings following intra-articular injection of autologous and allogeneic placentally derived equine mesenchymal stem cells in horses. Cytotherapy 13: 419–430; 2011b. Chambers I.; Colby D.; Robertson M.; Nichols J.; Lee S.; Tweedie S.; Smith A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113: 643–655; 2003. Cremonesi F.; Corradetti B.; Lange-Consiglio A. Fetal adnexa derived stem cells from domestic animal: progress and perspectives. Theriogenology 75: 1400–1415; 2011. de Mattos Carvalho A.; Alves A. L.; Golim M. A.; Moroz A.; Hussni C. A.; de Oliveira P. G.; Deffune E. Isolation and immunophenotypic characterization of mesenchymal stem cells derived from equine species adipose tissue. Vet. Immunol. Immunopathol. 132: 303– 306; 2009. De Schauwer C.; Meyer E.; Cornillie P.; De Vliegher S.; van de Walle G. R.; Hoogewijs M.; Declercq H.; Govaere J.; Demeyere K.; Cornelissen M.; Van Soom A. Optimization of the isolation culture and characterization of equine umbilical cord blood mesenchymal stromal cells. Tissue Eng. C Methods 17: 1061–1070; 2011.
MOHANTY ET AL. De Schauwer C.; Piepers S.; Van de Walle G. R.; Demeyere K.; Hoogewijs M. K.; Govaere J. L. J.; Braeckmans K.; VanSoom A.; Meyer E. In search for cross-reactivity to immunophenotype equine mesenchymal stromal cells by multicolor flow cytometry. Cytometry A 81: 312–323; 2012. Dhar M.; Neilse N.; Beatty K.; Eake S.; Adair H.; Geiser G. Equine peripheral blood derived mesenchymal stem cells: isolation, identification, trilineage differentiation and effect of hyperbaric oxygen treatment. Equine Vet. J. 44: 600–605; 2012. Docheva D.; Hunzike E. B.; Fassler R.; Brandau O. Tenomodulin is necessary for tenocyte proliferation and tendon maturation. Mol. Cell. Biol. 25: 699–705; 2005. Dominici M.; Le Blanc K.; Mueller I. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy Position Statement. Cytotherapy 8: 315–317; 2006. Godwin E. E.; Young N. J.; Dudhia J.; Beamish I. C.; Smith R. K. W. Implantation of bone marrow-derived mesenchymal stem cells demonstrates improved outcome in horses with overstrain injury of the superficial digital flexor tendon. Equine Vet. J. 44: 25–32; 2011. Hoynowski S. M.; Fry M. M.; Gardner B. M.; Leming M. T.; Tucker J. R.; Black L.; Sand T.; Mitchell K. E. Characterization and differentiation of equine umbilical cord-derived matrix cells. Biochem. Biophys. Res. Commun. 362: 347–53; 2007. Iacono E.; Brunori L.; Pirrone A.; Pagliaro P. P.; Ricci F.; Tazzari T. L.; Merlo B. Isolation characterization and differentiation of mesenchymal stem cells from amniotic fluid umbilical cord blood and Wharton’s jelly in the horse. Reproduction 143: 455–468; 2012. Ibrahim S.; Saunders K.; Kydd J. H.; Lunn D. P.; Steinbach F. Screening of anti-human leukocyte monoclonal antibodies for reactivity with equine leukocytes. Vet. Immunol. Immunopathol. 119: 63–80; 2007. Ito Y.; Toriuchi N.; Yoshitaka T.; Ueno-Kudoh H.; Sato T.; Yokoyama S.; Nishida K.; Akimoto T.; Takahashi M.; Miyaki S.; Asahara H. The Mohawk homeobox gene is a critical regulator of tendon differentiation. Proc. Natl. Acad. Sci. U. S. A. 107: 10538–42; 2010. Kakinuma S.; Tanaka Y.; Chinzei R.; Watanabe M.; Shimizu-Saito K.; Hara Y.; Teramoto K.; Arii S.; Sato C.; Takase K.; Yasumizu T.; Teraoka H. Human umbilical cord blood as a source of transplantable hepatic progenitor cells. Stem Cells 21: 217–227; 2003. Koch T. G.; Berg L. C.; Betts D. H. Current and future regenerative medicine-principles concepts and therapeutic use of stem cell therapy and tissue engineering in equine medicine. Can. Vet. J. 50: 155– 165; 2009. Koch T. G.; Heerkens T.; Thomsen P. D.; Betts D. H. Isolation of mesenchymal stem cells from equine umbilical cord blood. BMC Biotechnol. 7: 26; 2007. Lange-Consiglio A.; Corradetti B.; Bizzaro D.; Magatti M.; Ressel L.; Tassan S.; Parolini O.; Cremonesi F. Characterization and potential applications of progenitor-like cells isolated from horse amniotic membrane. J. Tissue Eng. Regen. Med. 6: 622–635; 2012. Lee J. Y.; Zhou Z.; Taub P. J.; Ramcharan M.; Li Y.; Akinbiyi T.; Mahram E. R.; Leong D. J.; Laudier D. M.; Ruike T.; Torinaz P. J.; Zaidi M.; Majeska R. J.; Schaffler M. B.; Flatow E. L.; Sun H. B. BMP-12 Treatment of adult mesenchymal stem cells in vitro augments tendon-like tissue formation and defect repair in vivo. Plos One 6(3): e17531; 2011. Lejard V.; Brideau G.; Blais F.; Salingcarnboriboon R.; Wagner G.; Roehrl M. H.; Noda M.; Duprez D.; Houillier P.; Rossert J. Scleraxis and NFATc regulate the expression of the pro-alpha1(I) collagen gene in tendon fibroblasts. J. Biol. Chem. 282: 17665– 17675; 2007. Lovati A. B.; Corradetti B.; Lange C. A.; Recordati C.; Bonacina E.; Bizzaro D.; Cremonesi F. Comparison of equine bone marrowumbilical cord matrix and amniotic fluid-derived progenitor cells. Vet. Res. Commun. 35: 103–121; 2011.
Moretti P.; Hatlapatka T.; Marten D.; Lavrentieva A.; Majore I.; Hass R.; Kasper C. Mesenchymal stromal cells derived from human umbilical cord tissues: primitive cells with potential for clinical and tissue engineering applications. Adv. Biochem. Eng. Biotechnol. 123: 29– 54; 2010. Niwa H.; Miyazaki J.; Smith A. G. Quantitative expression of Oct-3/4 defines differentiation dedifferentiation or self-renewal of ES cells. Nat. Genet. 24: 372–376; 2000. Raabe O.; Shell K.; Fietz D.; Freitag C.; Ohrndorf A.; Christ H. J.; Wenisch S.; Arnhold S. Tenogenic differentiation of equine adipose-tissue-derived stem cells under the influence of tensile strain growth differentiation factors and various oxygen tensions. Cell Tissue Res. 352: 509–521; 2013. Radcliffe C. H.; Flaminio M. J.; Fortier L. A. Temporal analysis of equine bone marrow aspirate during establishment of putative mesenchymal progenitor cell populations. Stem Cells Dev. 19: 269–282; 2010. Ranera B.; Lyahyai J.; Romeroa A.; Vázqueza J. F.; Remachaa A. R.; Bernalc M. L.; Zaragozaa P.; Rodellara C.; Martín-Burriela I. Immunophenotype and gene expression profiles of cell surface markers of mesenchymal stem cells derived from equine bone marrow and adipose tissue. Vet. Immunol. Immunopathol. 144: 147–154; 2011. Reed S. A.; Johnson S. E. Equine umbilical cord blood contains a population of stem cells that express Oct4 and differentiate into mesodermal and endodermal cell types. J. Cell. Physiol. 215: 329– 336; 2008. Romanov Y. A.; Svintsitskaya V. A.; Smirnov V. N. Searching for alternative sources of postnatal human mesenchymal stem cells: candidate MSC-like cells from umbilical cord. Stem Cells 21: 105– 110; 2003. Schuh E. M.; Friedman M. S.; Carrade D. D.; Heeke D.; Oyserman S. M.; Galuppo L. D.; Lara D. J.; Walker N. J.; Ferraro G. L.; Owens S. D.; Borjesson D. L. Identification of variables that optimize isolation and culture of multipotent mesenchymal stem cells from equine umbilical-cord blood. Am. J. Vet. Res. 70: 1526–1535; 2009. Schweitzer R.; Chyung J. H.; Murtaugh L. C.; Brent A. E.; Rosen V.; Olson E. N.; Lassar A.; Tabin C. J. Analysis of the tendon cell fate using Scleraxis a specific marker for tendons and ligaments. Development 128: 3855–3866; 2001. Sibov T. T.; Severino P.; Marti L. C.; Pavon L. F.; Oliveira D. M.; Tobo P. R.; Campos A. H.; Paes A. T.; Amaro E.; Gamarra L. F.; MoreiraFilho C. A. Mesenchymal stem cells from umbilical cord blood: parameters for isolation, characterization and adipogenic differentiation. Cytotechnology 64: 511–521; 2012. Sieber C.; Kopf J.; Hiepen C.; Knaus P. Recent advances in BMP receptor signaling. Cytokine Growth Factor Rev. 20: 343–355; 2009. Stenderup K.; Justesen J.; Clausen C.; Kassem M. Aging is associated with decreased maximal life span and accelerated senescence of bone marrow stromal cells. Bone 33: 919–926; 2003. Tarnok A.; Ulrich H.; Bocsi J. Phenotypes of stem cells from diverse origin. Cytometry A 77: 6–10; 2010. Tsai C. C.; Hung S. C. Functional roles of pluripotency transcription factors in mesenchymal stem cells. Cell Cycle 11: 3711–3712; 2012. Vidal M. A.; Kilroy G. E.; Lopez M. J.; Johnson J. R.; Moore R. M.; Gimble J. M. Characterization of equine adipose tissue-derived stromal cells: adipogenic and osteogenic capacity and comparison with bone marrowderived mesenchymal stromal cells. Vet. Surg. 36: 613–622; 2007. Vidal M. A.; Robinson S. O.; Lopez M. J.; Paulsen D. B.; Borkhsenious O.; Johnson J. R.; Moore R. M.; Gimble J. M. Comparison of chondrogenic potential in equine mesenchymal stromal cells derived from adipose tissue and bone marrow. Vet. Surg. 37: 713–724; 2008. Violini S.; Ramelli P.; Pisani L. F.; Gorni C.; Mariani P. Horse bone marrow mesenchymal stem cells express embryo stem cell markers and show the ability for tenogenic differentiation by in vitro exposure to BMP-12. BMC Cell Biol. 10: 29; 2009.
TENOGENIC DIFFERENTIATION OF EQUINE UCB-MSCSS Wang Q. W.; Chen Z. L.; Piao Y. J. Mesenchymal stem cells differentiate into tenocytes by bone morphogenetic protein (BMP) 12 gene transfer. J Biosci. Bioeng. 100: 418–422; 2005. Wolfman N. M.; Hattersley G.; Cox K.; Celeste A. J.; Nelson R. Ectopic induction of tendon and ligament in rats by growth and differentiation factors 5, 6, and 7, members of the TGF-beta gene family. J. Clin. Invest. 100: 321–330; 1997.
Zhang G.; Ezura Y.; Chervoneva I.; Robinson P. S.; Beason D. P.; Carine E. T.; Soslowsky L. S.; Iozzo R. V.; Birk D. E. Decorin regulates assembly of collagen fibrils and acquisition of biomechanical properties during tendon development. J. Cell. Biochem. 98: 1436–1449; 2006. Zhang L.; Chan C. Isolation and enrichment of rat mesenchymal stem cells (MSCs) and separation of single-colony derived MSCs. J. Vis. Exp. 22: 1852; 2010.