Med Oncol (2013) 30:688 DOI 10.1007/s12032-013-0688-3

ORIGINAL PAPER

Increased expression of TBX2 is a novel independent prognostic biomarker of a worse outcome in colorectal cancer patients after curative surgery and a potential therapeutic target Yang Han • Wei-Wei Tu • Yu-Gang Wen Dong-Wang Yan • Guo-Qiang Qiu • Zhi-Hai Peng • Chong-Zhi Zhou

•

Received: 7 July 2013 / Accepted: 6 August 2013 / Published online: 20 August 2013 Ó Springer Science+Business Media New York 2013

Abstract T-box2 (TBX2) plays a critical role in embryonic development. Recently, deregulated expression of TBX2 has been implicated in several malignancies. However, the expression and the role of TBX2 in colorectal cancer (CRC) remain unclear. In this study, we found that TBX2 was obviously up-regulated in CRC in comparison with the corresponding normal mucosa at transcriptional and protein level. Up-expression of TBX2 was significantly associated with depth of tumor invasion (P = 0.006), distant metastasis (P = 0.038), advanced AJCC stage (P = 0.008), and relapse (P = 0.003). TBX2 was a significantly prognostic factor for decreased survival and increased disease recurrence independent of tumor stage(II, III stage) and functioned as a biomarker to identify prognosis of patients with CRC (OS: HR 2.154; 95 % CI 1.019–4.551; P = 0.044, DFS: HR 2.253; 95 % CI 1.109–4.575; P = 0.025). Furthermore, TBX2 could serve as a potential target of cancer drug therapy.

Yang Han and Wei-Wei Tu contributed equally to this work.

Electronic supplementary material The online version of this article (doi:10.1007/s12032-013-0688-3) contains supplementary material, which is available to authorized users. Y. Han  Y.-G. Wen  D.-W. Yan  G.-Q. Qiu  Z.-H. Peng  C.-Z. Zhou (&) Department of General Surgery, Shanghai First People’s Hospital, School of Medicine, Shanghai Jiao Tong University, 85 Wujin Road, Shanghai 20080, China e-mail: [email protected] W.-W. Tu Department of General Surgery, Shanghai First People’s Hospital, Nanjing Medical University, 140 Hanzhoung Road, Nanjing 210029, China

Keywords TBX2  Colorectal cancer  Prognosis  Biomarker  Drug target

Introduction Colorectal cancer (CRC) is the third most commonly diagnosed cancer and the fourth leading cause of death from cancer worldwide [1]. Although screening strategies (endoscopic and CT-colonoscopy) have supposed a great advance in the early detection and improving the survival rates of CRC, they cause many inconveniences such as their cost and difficulty in popularity. Moreover, several serum biomarkers used in clinical practice, including CEA [2], CA19-9 [3], and CA50 [4], have no a high sensitivity of the diagnosis for CRC, particularly in the early stage. Therefore, to further improve the survival rates, it is crucial to search for a more sensitive biomarker for the early detection and more convenient intervention with the prognosis for CRC. It is known that the processes of normal embryogenesis and tumorigenesis share many of the same pathways, and tumorigenesis is an aberrant form of organogenesis [5, 6]. Therefore, it is significant for elucidation the mechanism of tumorigenesis clearly to study on closely related components of abnormal organogenesis and embryogenesis. T-box2 (TBX2) is a member of the T-box family of transcription factors, which plays a critical role in embryonic development. TBX2 is expressed in a wide range of tissues and organs including limb buds [7], kidneys [8], lungs [9], mammary gland mesenchyme [10], heart [11], melanocyte [12], and gastrulation [13]. In addition, recent studies indicate that TBX2 has been implicated in cell cycle regulation and cancer. TBX2 gene is deregulated in breast [14, 15], melanoma [16], and pancreatic cancers [17]. However, very

123

Page 2 of 8

little is known about the expression and the role of TBX2 in CRC. Consequently, TBX2, as a classic example of the intimate relationship between intestinal embryogenesis and colorectal tumorigenesis, provides a good point to explore the mechanism of colorectal tumorigenesis. In the present study, we investigated the expression of TBX2 in CRC by qRT-PCR, Western blot, and immunohistochemistry and then analyzed the correlations between TBX2 expression and its clinicopathological parameters. In the end, we verified that TBX2 was obviously up-regulated in CRC in comparison with the corresponding normal mucosa at transcriptional and protein level. Up-expression of TBX2 was significantly associated with highly aggressive phenotype of CRC. Therefore, in our study, we reported first that TBX2 was a prognostic factor for CRC independent of tumor stage (II, III stage) and could possibly be used as a biomarker to identify prognosis of patients with CRC. Furthermore, we suggested that TBX2 might serve as a potential target of cancer drug therapy.

Med Oncol (2013) 30:688

TBX2, sense 50 -AGTGGATGGCTAAGCCTGTG-30 and antisense 50 - ACGGGTT GTTGTCGATCTTC-30 (249 bp); and GAPDH, sense 50 - GTCCACCACCCTG TTGCTGT A-30 and antisense 50 - CTTCAACAGCGACACCCACTC -30 (124 bp). Quantitative PCRs were performed on a Mastercycler ep Realplex (Eppendorf Hamburg, Germany) with an IQTM SYBR Green Supermix Kit (BIO-RAD, Berkeley, CA) according to the manufacturer’s protocol. Cycling conditions were as follows: 95 °C for 10 min, then 40 cycles of 95 °C for 10 s, 57 °C for 20 s, and 72 °C for 60 s, with a final extension at 72 °C for 5 min. GAPDH was used as the internal control in all the samples. Each reaction was performed in triplicate, and the mean TBX2 mRNA level for each tumor was compared with its matched nontumorous mucosa. The fold change (2-DDCt) of TBX2 expression in each paired sample was calculated by using the following formulas: TBX2DCt = (Avg.TBX2_Ct–Avg.GAPDH_Ct), TBX2DDCt = (TBX2DCt _tumor–TBX2DCt _nontumor). Western blot

Materials and methods Patients and tissues specimens A total of 119 patients who had curative surgery for CRC by the same surgical team at Shanghai First People’s Hospital from 2001 to 2003 were enrolled in the study. The group was composed of 72 males and 47 females with a mean age of 68 (range 22–95) years. American Joint Committee on Cancer (AJCC) stage I, II, III, and IV were 19, 73, 23, and 4 cases, respectively. None of the patients underwent preoperative chemotherapy and/or radiation therapy. All diagnoses were confirmed by two pathologists, and the tumor grade and stage classifications were assigned according to the AJCC [18]. The cancer tissues and their matched normal mucosa were collected immediately after surgical resection, frozen instantly in liquid nitrogen, or infused in formaldehyde solution until analysis. Patient-derived specimens were collected and archived under protocols approved by the Institutional Review Boards of Shanghai First People’s Hospital Affiliated to Shanghai Jiao Tong University. All of the patients gave their informed consent for the use of their tissue samples in this study [19]. RNA extraction, quantitative real-time PCR Total RNA from 32 random couples of fresh CRC and adjacent noncancerous mucosa were extracted according to the manufacturer’s instructions (Qiagen, Hilden, Germany), and then, 1 lg RNA was reverse transcribed into complementary DNA (Promega Corporation, Madison, WI, USA). cDNA (20 ng) was used as a template for the specific PCR. The primers used for RT-PCR were as follows:

123

Total proteins were extracted from 4 randomly selected, paired, frozen colorectal tumor tissues and adjacent normal tissues by an ice-cold radioimmunoprecipitation assay lysis buffer (50 mM Tris pH7.4, 150 mM NaCl, 1 % NP-40, 0.5 %sodium deoxycholate and 0.1 % sodium dodecyl sulfate). Protein concentrations were measured using a BCA protein assay kit (Beyotime Biotechnology Co., Jiangsu, China). Equivalent amounts of proteins were separated on 10 % SDS-PAGE and transferred onto PVDF membranes (Millipore, Billerica, MA) using standard protocols. The membrane was blocked in a 5 % fat-free milk solution for 1 h at room temperature, followed by incubation with a rabbit anti-human TBX2 polyclonal antibody (1:500, Abcam, Cambridge, UK) or b-actin antibody(1:1000, Epitomics, Burlingame, USA) at 4 °C overnight. After washing with TBST buffer, blots were incubated with a goat anti-rabbit IgG HRP-conjugated secondary antibody (1:5000, Santa Cruz, CA) for 1 h. The bound antibodies were detected using enhanced chemiluminescence (Millipore) and were exposed to X-ray film. TMA construction The tissue microarrays (TMA) were made from paired tumor and nontumor tissues from 119 patients, which were retrieved from the archives of the Department of Pathology in our hospital. Representative areas of tissue were established, and 2.0-mm diameter cores were punched from the paraffin blocks. The tumor and normal mucosa samples from the same patient were spotted next to each other to ensure similar reaction conditions. All specimens were examined by two pathologists to prevent bias. Tumor and normal

Med Oncol (2013) 30:688

mucosa morphology on the arrays were validated as having high accordance with the whole archived section [19]. Immunohistochemistry The TMA sections were deparaffinized in xylene and rehydrated in graded series of ethanols followed by pressure cooker-mediated epitope retrieval in citrate buffer (pH 6.0). TBX2 expression was detected using a primary antibody against TBX2 (1:700, Abcam, Cambridge, UK). After incubation with goat anti-mouse or anti-rabbit Envision System Plus-HRP (Dako Cytomation, Glostrup, Denmark), the slides were rinsed and counterstained with Mayer’s hematoxylin. Two independent investigators scored the sections without knowledge of the patient outcome (double-blinded). The evaluation was based on staining intensity and extent of TBX2 as described [20]. Staining intensity was graded as follows: 0, no staining; 1?, mild staining; 2?, moderate staining; and 3?, intense staining. The staining area was scored using the following scale: 0, no staining of cells; 1?, \10 % of tissue stained positive; 2?, 10–50 % stained positive; and 3?, [50 % stained positive. The sum of staining score (intensity ? extension) index was designated as follows: 0–2, negative expression; 3–4, weak expression; and 5–6, strong expression. When discrepancy in an assessment was encountered, the slides were re-examined by both pathologists under a multi-head microscope to obtain an agreement. Statistical analysis SPSS 13.0 statistical software (SPSS Inc.; Chicago, USA) was used to conduct statistical analyses. T test was used for analyzing the differences of TBX2 mRNA expression between cancerous tissues and paired normal mucosa. The v2test or Fisher’s exact test was used, where appropriate, to analyze the relationship between TBX2 expression and its clinicopathological parameters based on immunohistochemistry. The survival rates were calculated by the Kaplan–Meier method, and the differences between the survival curves were examined by the log-rank test. The Cox proportional hazards model was used to investigate multivariate analysis and independent prognostic factors. P-values \0.05 were considered to be statistically significant.

Results Up-regulation of TBX2 expression in primary colon cancer compared with adjacent normal mucosa Of the 32 paired cases used for the evaluation of TBX2 mRNA expression, 19 (59.4 %) CRCs showed at least a

Page 3 of 8

twofold increase in TBX2 mRNA level compared with the adjacent, noncancerous mucosa(P = 0.038) (Fig. 1a). Subsequent Western blotting confirmed that TBX2 protein levels were significantly up-regulated in cancerous tissues (Fig. 1b). Up-regulation expression of TBX2 proteins by immunohistochemistry Of the 119 normal mucosa specimens in the paired TMA, 84 (70.6 %) showed negative TBX2 expression, and only 7 (5.9 %) specimens displayed strong positive staining. In contrast, among the 119 samples of CRC, 87 (73.1 %) were positive and 47 (39.5 %) of them were strong positive (Table 1; Fig. 2).Therefore, the results indicated that TBX2 expressions were significantly up-regulated in cancerous tissues compared with the corresponding noncancerous mucosa (P \ 0.001). Association of TBX2 TMA immunohistochemical staining with patient clinicopathological parameters Associations between clinicopathological parameters and TBX2 expression are summarized in Table 2. Up-regulated expression of TBX2 was significantly correlated with depth of tumor invasion (pT stage) (P = 0.006), distant metastasis (M stage) (P = 0.038),advanced AJCC stage (P = 0.008), and relapse (P = 0.003). Moreover, among 47 samples of TBX2 strong positive expression, 43 (91.5 %) of them showed T3–T4 tumor invasion, which suggested that TBX2 was closely related to metastasis of CRC . Survival analysis and prognostic significance of TBX2 expression As shown in Fig. 3 and Table 3a, b, patients with positive TBX2 expression had an obviously lower overall survival (OS) and disease-free survival (DFS) rate than patients with negative TBX2 expression (HR 2.798, 95 % CI 1.537–5.095, P = 0.001; HR 2.619, 95 % CI 1.444–4.752, P = 0.002, respectively). Kaplan–Meier curves showed that the rate of recurrence was significantly elevated with positive TBX2 expression. A total of 37 of the 119 (31.1 %) patients who underwent curative operations experienced disease relapse and 22 of them (22/37, 59.5 %) recurred disease within 36 months of surgery (median 35 months, range 5–65 months). Moreover, positive TBX2 expression was strongly associated with an increased risk of tumor recurrence as compared with negative TBX2 expression (HR 181.412; 95 % CI 22.933–1435.083; P \ 0.001). However, there was no significant relationship between TBX2 level of expression and time to onset of recurrent

123

Page 4 of 8

Med Oncol (2013) 30:688

Fig. 1 TBX2 mRNA expression in 32 paired colon cancer samples and adjacent normal mucosa was evaluated by real-time PCR, (a) and protein expression in 4 pairs of colon cancer tissues was measured by Western blot (b). Most cancer samples (22/32) showed higher levels of TBX2 mRNA expression than the normal mucosa. Among the 32 paired cancer samples, 19 (59.4 %) colorectal cancers showed at least a two-fold increase in TBX2 mRNA level compared with the adjacent, non-cancerous mucosa (2-DDCt, logarithmic scale, P = 0.038). Moreover, most tumor samples (T) showed significantly higher levels of TBX2 protein expression compared with noncancerous tissue (N)

Fig. 2 Immunohistochemical staining of TBX2 expression in normal tissue and colon cancer. TBX2 staining was observed both in the nuclear and cytoplasm of colorectal cancer cells. TBX2 protein expression was obviously higher in cancer tissues compared with that

in normal mucosa. a Normal colorectal epithelium; b well-differentiated colorectal cancer; c moderately differentiated colorectal cancer; d poorly differentiated colorectal cancer. a–d Original magnification 950; e–h original magnification 9200

disease (negative, range 29–52 months; weak, 16–58 months; strong, 5–65 months; P = 0.694). The univariate analysis revealed that both decreased OS and DFS were associated with pT stage (P = 0.024; P = 0.019, respectively), pN stage (P \ 0.001), distant metastasis (P \ 0.001), AJCC stage (P \ 0.001), differentiation (P \ 0.001), vascular invasion (P \ 0.001), relapse (P \ 0.001), and TBX2 expression (P = 0.001;

P = 0.002, respectively). Moreover, the multivariate analysis showed that positive TBX2 expression remained a significantly independent prognostic factor for decreased survival and increased disease recurrence (OS:HR 2.154; 95 % CI 1.019–4.551; P = 0.044, DFS:HR 2.253; 95 % CI 1.109–4.575; P = 0.025). To further define up-regulated TBX2 expression as an independent factor influencing tumor recurrence irrespective

123

Med Oncol (2013) 30:688

Page 5 of 8

Fig. 3 Survival curve of the colorectal cancer patients with regard to TBX2 expression. The patients with TBX2 positive expression had a significantly lower overall survival (a) and/or disease-free survival (b) rate than the TBX2 negative group (P = 0.003, P = 0.008, respectively) Table 1 Expression of TBX2 in normal colon mucosa and cancer tissues

Discussion

Tissue sample

N

Normal mucosa Colon cancer

T-box2 is a member of the T-box family of transcription factors that are characterized by a highly conserved region of approximately 200 amino acid residues corresponding to the DNA binding domain known as the T-box. TBX2 is crucial in embryonic development and has been implicated in several developmental processes, such as patterning and morphogenesis of a wide range of tissues and organs, including limb buds [7], kidneys [8], lungs [9], mammary gland mesenchyme [10], heart [11], melanocyte [12], and gastrulation [13]. Moreover, TBX2 has also been involved in cell cycle regulation and carcinogenesis. Barlund et al. [14] found that amplification of the chromosomal region 17q22-q24 was common in breast cancer by comparative genomic hybridization. TBX2, located at 17q23, was showed to be highly amplified and overexpressed in breast cancer cell lines through FISH. Meanwhile, Jacobs et al. [15] revealed TBX2 in a genetic senescence bypasses screen to potently down-regulate the p19ARF tumor suppressor, thereby causing efficient immortalization of primary fibroblasts. Finally, he found TBX2 to be amplified in a subset of primary human breast cancers, indicating that it might contribute to breast cancer development. Moreover, Vance et al. [16] examined TBX2 expression levels in a series of human and mouse melanoma cell lines as well as primary human melanocytes and the mouse melanocyte cell line melan-c by Western blot. He found that TBX2 was poorly expressed in the melanocyte cell line, while it was overexpressed in all melanoma cell lines tested and played an important role in maintaining proliferation and suppression of senescence in

TBX2 expression Negative (%)

Weak (%)

Strong (%)

P-value

119

84 (70.6 %)

28 (23.5 %)

7 (5.9 %)

\0.001*

119

32 (26.9 %)

40 (33.6 %)

47 (39.5 %)

P-values are based on chi-squared test * Significant difference

of clinical disease stage, an analysis was performed with adjustment for AJCC stage stratification (Fig. S1). It was found that there was no significant difference in TBX2 expression groups of patients with stage I disease, which might need to be explained by future research with an expanded sample set. However, significant differences in DFS were detected in patients with stage II and III disease. The 5-year DFS rates in stage II patients of negative, weak, and positive TBX2 expression were 100, 90.23, and 77.74 %, respectively, and in stage III were 66.67, 60, and 14.29 %, respectively. Moreover, all of the 4 patients with stage IV disease were strong positive TBX2 staining and all of them experienced tumor recurrence within 3 years after radical resection. Therefore, these data indicate that even in the same stage, patients with positive TBX2 expression had lower relapse-free survival rates than those with negative staining. Increased TBX2 levels were associated with a shorter relapsefree duration independent of tumor staging.

123

Page 6 of 8

Med Oncol (2013) 30:688

Table 2 Correlation between TBX2 expression and clinicopathological features in patients with CRC (N = 119) N

TBX2 expression Negative

Weak positive

Strong positive

Age

0.712

\65 years

51

12

19

20

C65 years

68

20

21

27

Male

72

18

25

29

Female

47

14

15

18

Right

56

17

19

20

Transverse

10

1

3

6

Descending

12

1

5

6

Sigmoid

41

13

13

15

Sex

0.865

Tumor location

0.542

0.006*

T stage T1

8

3

2

3

T2 T3

17 47

11 10

5 16

1 21

T4

47

8

17

22

N0

92

26

30

36

N1

24

6

8

10

N2

3

0

2

1

N stage

0.869

0.038*

M stage M0

115

32

40

43

M1

4

0

0

4 0.008*

AJCC stage I

19

11

5

3

II

73

15

25

33

III

23

6

10

7

IV

4

0

0

4

Differentiation Well

0.547 58

15

19

24

Moderate

49

14

19

16

Poorly

12

3

2

7

117

32

39

46

2

0

1

1

Vascular invasion No Yes

P-value

1.000

0.003*

Relapse No

82

29

27

26

Yes

37

3

13

21

P-values are based on chi-squared or Fisher’s exact test * Significant difference

melanomas. Furthermore, Mahlamaki et al. [17] detected that TBX2 was amplified in 50 % of 31 pancreatic cancer cell lines tested by fluorescence in situ hybridization. Therefore, TBX2 was overexpressed in several cancers,

123

including breast, pancreatic, and melanoma where it was shown to function as a tumor-related gene. However, very little was known about whether TBX2 was deregulated in CRC. T-box2 was showed to play a role in morphogenesis and differentiation of the gastrulation [13]. The processes of normal embryogenesis and tumorigenesis were known to share many of the same pathways, and tumorigenesis was an aberrant form of organogenesis [5, 6]. TBX2 was a typical example of the intimate relationship between intestinal embryogenesis and colorectal tumorigenesis. Therefore, it was significant for exploring colorectal tumorigenesis to make clear the expression and mechanism of TBX2 in CRC. In the present study, we first measured TBX2 expression in fresh frozen specimens of colon cancer and found that TBX2 mRNA and protein expression levels in colorectal tumor tissues were higher than in the corresponding noncancerous mucosa. It was suggested that TBX2 was upregulated at both transcriptional and posttranscriptional levels. Further validation by immunohistochemistry showed that 73.1 % (87/119) of CRCs displayed positive staining, while only 29.4 % (35/119) of normal colorectal tissues were immunoreactive for TBX2, including weakly positive specimens. These data indicated that TBX2 might take part in the progression of colon carcinogenesis. The reason why the positive rate of TBX2 staining in the normal tissues was not very low might be a biological property of TBX2, which was implicated in the embryonic development. Furthermore, Duo et al. [21] reported previously in pancreatic cancer that TBX2 was closely related to tumor differentiation degree, higher TNM stage, and distant metastasis. However, the number of specimens which he conducted to investigate was only 40 pairs, and he did not make a survival analysis. Currently, there have been no published reports on TBX2 expression in CRC and the association between TBX2 expression and its clinicopathological features. Our results showed significant correlations between tumor TBX2 overexpression and pT stage, distant metastasis, advanced AJCC stage and relapse. These data indicate that up-regulated TBX2 might contribute to tumor invasion and metastasis. Therefore, TBX2 could be possible to serve as a biomarker to identify subsets of colon cancer with a more aggressive phenotype. After literature search, we found that Dimova et al. [22] identified TBX2 as a specific genomic marker for late-stage ovarian cancers. Similarly, Kandimalla et al. [23] recognized TBX2 as pTa-specific prognostic markers in bladder cancer. Was there a possibility that TBX2 might be used as a biomarker to identify prognosis of patients with CRC? In our current study, patients with up-regulated TBX2 expression had a lower survival rate. Even in the same

Med Oncol (2013) 30:688

Page 7 of 8

Table 3 Univariate and multivariate analysis Variable

Univariate analysis HR

95 %CI

Multivariate analysis P-value

HR

95 %CI

P-value

(a) Overall survival after surgery Age

1.263

0.571–2.790

0.564

NR

Gender

1.209

0.539–2.715

0.645

NR

Location

1.066

0.804–1.414

0.655

NR

T stage

1.898

1.089–3.309

0.024*

N stage

5.780

3.161–10.568

\0.001*

11.331 4.617

3.297–38.938 2.684–7.944

\0.001* \0.001*

M stage AJCC stage Differentiation Vascular invasion Relapse TBX2

3.692

2.091–6.520

\0.001*

16.815

3.694–76.537

\0.001*

103.235

13.829–770.640

2.798

NR 2.410

1.279–4.541

0.007*

NR NR 2.646

1.425–4.913

0.002*

NR

\0.001*

54.334

1.537–5.095

0.001*

2.154

6.945–425.079 1.019–4.551

\0.001* 0.044*

(b) Disease-free survival after surgery Age

1.263

0.573–2.784

0.562

NR

Gender

1.211

0.539–2.717

0.643

NR

Location

1.069

0.807–1.416

0.642

NR

T stage

1.937

1.113–3.371

0.019*

N stage

7.158

3.696–13.863

\0.001*

M stage

12.952

3.674–45.661

\0.001*

AJCC stage

4.756

2.727–8.294

\0.001*

Differentiation

3.536

2.031–6.154

\0.001*

Vascular invasion Relapse TBX2

24.027 181.412 2.619

4.782–120.720 22.933–1435.083 1.444–4.752

NR 4.265

1.960–9.281

\0.001*

NR NR 2.642

\0.001* \0.001*

119.433

0.002*

2.253

1.431–4.879 NR 13.681–1042.614 1.109–4.575

0.002* \0.001* 0.025*

HR hazard radio, CI confidence interval, NR variable were not included in the resultant model * Significant difference

tumor stage (II, III stage), patients with positive TBX2 expression had worse survival rates than patients with negative expression. In addition, positive TBX2 expression was strongly associated with an increased risk of tumor recurrence as compared with negative TBX2 expression (HR 181.412; 95 % CI 22.933–1435.083; P \ 0.001). In the end, through the univariate and multivariate Cox model analysis, we confirmed that TBX2 could serve as a significant independent prognostic factor for CRC. The mechanism by which TBX2 contributes to tumorigenesis and cancer progression has not been well elucidated. A possible explanation for tumorigenesis of TBX2 is suggested to be able to function as immortalizing genes that enable the cells to bypass senescence. Jacobs et al. [15] first showed that TBX2 had an ability to facilitate senescence bypass in Bmi-/-mouse embryo fibroblasts when moderately overexpressed. TBX2 was found to be able to repress the Cdkn2a (p19ARF, p14ARF in humans) promoter and attenuate E2F1, Myc, or HRAS-mediated induction of Cdkn2a (p19ARF). Moreover, Vance et al. [16] revealed that TBX2 could associate with histone deacetylase 1

(HDAC1) to repress the p21Cip1 (CDKN1A) initiator both in vitro and in vivo, whereas activation of an inducible dominant-negative TBX2 (dnTBX2) leaded to the displacement of HDAC1, up-regulation of p21Cip1 expression, and the induction of replicative senescence in CDKN2Anull B16 melanoma cells. Therefore, TBX2 could function as an immortalizing gene enabling cells to bypass senescence by inhibiting cyclin-dependent kinase inhibitors, p19ARF and p21. Cellular senescence is a protective mechanism against cancer. TBX2 might contribute to tumorigenesis by inhibiting the program of senescence. Another mechanism revealed that TBX2 could acquire the ability to bypass initial block in cytokinesis, which resulted in the formation of genetically unstable polyploidy cells. Davis et al. [24] discovered that TBX2-reexpressing cells were arrested at either a G2or M checkpoint and then resulted in an increase in frequency of several features of genomic instability such as chromosome missegregation, chromosomal rearrangements, and polyploidy in comparison with their parental cells. Therefore, he suggested that TBX2 may make an effect on key cell cycle proteins

123

Page 8 of 8

Med Oncol (2013) 30:688

involved in regulating these two checkpoints. TBX2 may contribute to oncogenesis through bypassing checkpoints, which enable tetraploid cells to re-enter the cell cycle. Noteworthily, the potential for using TBX2 as targets of cancer therapy is now being explored. TBX2 is overexpressed in various cancers, functioning as a potential oncogene. Such results provide a possibility of using TBX2 as a therapeutic target. HDAC inhibitor, vorinostat, has been approved for the treatment for cutaneous T-cell lymphoma (CTCL) by the US FAD [25]. Given that HDAC inhibitors could inhibit the function of TBX2, they might have a good effect to treat malignancies with overexpressed TBX2. Thus far, this is the first report to highlight the clinical significance of TBX2 in CRC. Our results indicated that up-expression of TBX2 might be associated with highly aggressive phenotype of CRC. TBX2 was a significant prognostic biomarker for CRC, independent of tumor stage. Overexpression of TBX2 in stage II and III colon cancer may correlate with disease recurrence. Furthermore, TBX2 has a potential for using as a therapeutic target of CRC. These preliminary results need to be verified in a larger, prospective, controlled, clinical study. Acknowledgments This project was supported by the National Natural Science Foundation of China, No. 81172330, No. 30700813, New medical younger talent of Shanghai Health Bureau (XYQ2011035) and ‘‘Climbing’’ Program of Shanghai Songjiang district (2011PD02). Conflict of interest

We declare that we have no conflict of interest.

References 1. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin. 2011;61(2):69–90. 2. Duffy MJ. Carcinoembryonic antigen as a marker for colorectal cancer: is it clinically useful? Clin Chem. 2001;47(4):624–30. 3. Nakayama T, Watanabe M, Teramoto T, Kitajima M. CA19-9 as a predictor of recurrence in patients with colorectal cancer. J Surg Oncol. 1997;66(4):238–43. 4. Kuusela P, Haglund C, Roberts PJ. Comparison of a new tumour marker CA 242 with CA 19-9, CA 50 and carcinoembryonic antigen (CEA) in digestive tract diseases. Br J Cancer. 1991; 63(4):636–40. 5. Reya T, Clevers H. Wnt signalling in stem cells and cancer. Nature. 2005;434(7035):843–50. 6. Taipale J, Beachy PA. The Hedgehog and Wnt signalling pathways in cancer. Nature. 2001;411(6835):349–54. 7. Gibson-Brown JJ, Agulnik SI, Silver LM, Niswander L, Papaioannou VE. Involvement of T-box genes Tbx2-Tbx5 in vertebrate limb specification and development. Development. 1998; 125(13):2499–509. 8. Cho GS, Choi SC, Park EC, Han JK. Role of Tbx2 in defining the territory of the pronephric nephron. Development. 2011;138(3): 465–74.

123

9. Kalinichenko VV, Lim L, Stolz DB, Shin B, Rausa FM, Clark J, Whitsett JA, Watkins SC, Costa RH. Defects in pulmonary vasculature and perinatal lung hemorrhage in mice heterozygous null for the Forkhead Box f1 transcription factor. Dev Biol. 2001; 235(2):489–506. 10. Jerome-Majewska LA, Jenkins GP, Ernstoff E, Zindy F, Sherr CJ, Papaioannou VE. Tbx3, the ulnar-mammary syndrome gene, and Tbx2 interact in mammary gland development through a p19Arf/ p53-independent pathway. Dev Dyn. 2005;234(4):922–33. 11. Harrelson Z, Kelly RG, Goldin SN, Gibson-Brown JJ, Bollag RJ, Silver LM, Papaioannou VE. Tbx2 is essential for patterning the atrioventricular canal and for morphogenesis of the outflow tract during heart development. Development. 2004;131(20):5041–52. 12. Carreira S, Liu B, Goding CR. The gene encoding the T-box factor Tbx2 is a target for the microphthalmia-associated transcription factor in melanocytes. J Biol Chem. 2000;275(29):21920–7. 13. Lustig KD, Kroll KL, Sun EE, Kirschner MW. Expression cloning of a Xenopus T-related gene (Xombi) involved in mesodermal patterning and blastopore lip formation. Development. 1996;122(12):4001–12. 14. Barlund M, Monni O, Kononen J, Cornelison R, Torhorst J, Sauter G, Kallioniemi O-P, Kallioniemi A. Multiple genes at 17q23 undergo amplification and overexpression in breast cancer. Cancer Res. 2000;60(19):5340–4. 15. Jacobs JJ, Keblusek P, Robanus-Maandag E, Kristel P, Lingbeek M, Nederlof PM, van Welsem T, van de Vijver MJ, Koh EY, Daley GQ, van Lohuizen M. Senescence bypass screen identifies TBX2, which represses Cdkn2a (p19(ARF)) and is amplified in a subset of human breast cancers. Nat Genet. 2000;26(3):291–9. 16. Vance KW, Carreira S, Brosch G, Goding CR. Tbx2 is overexpressed and plays an important role in maintaining proliferation and suppression of senescence in melanomas. Cancer Res. 2005;65(6):2260–8. 17. Mahlamaki EH, Barlund M, Tanner M, Gorunova L, Hoglund M, Karhu R, Kallioniemi A. Frequent amplification of 8q24, 11q, 17q, and 20q-specific genes in pancreatic cancer. Genes Chromosomes Cancer. 2002;35(4):353–8. 18. Greene FL, Page DL, Fleming ID, Balch CM, Fritz AG. AJCC cancer staging manual, vol. 6. New York: Springer Verlag; 2002. 19. Yan DW, Li DW, Yang YX, Xia J, Wang XL, Zhou CZ, Fan JW, Wen YG, Sun HC, Wang Q, Qiu GQ, Tang HM, Peng ZH. Ubiquitin D is correlated with colon cancer progression and predicts recurrence for stage II–III disease after curative surgery. Br J Cancer. 2010;103(7):961–9. 20. Bachmann IM, Halvorsen OJ, Collett K, Stefansson IM, Straume O, Haukaas SA, Salvesen HB, Otte AP, Akslen LA. EZH2 expression is associated with high proliferation rate and aggressive tumor subgroups in cutaneous melanoma and cancers of the endometrium, prostate, and breast. J Clin Oncol. 2006;24(2):268–73. 21. Duo S, Tiao-Dong T, Lei Z, Wei W, Hong-Li S, Xian-Wei D. Expression and clinical significance of tbx2 in pancreatic cancer. Asian Pac J Cancer Prev. 2009;10(1):118–22. 22. Dimova I, Orsetti B, Negre V, Rouge C, Ursule L, Lasorsa L, Dimitrov R, Doganov N, Toncheva D, Theillet C. Genomic markers for ovarian cancer at chromosomes 1, 8 and 17 revealed by array CGH analysis. Tumori. 2009;95(3):357–66. 23. Kandimalla R, van Tilborg AA, Kompier LC, Stumpel DJ, Stam RW, Bangma CH, Zwarthoff EC. Genome-wide analysis of CpG island methylation in bladder cancer identified TBX2, TBX3, GATA2, and ZIC4 as pTa-specific prognostic markers. Eur Urol. 2012;61(6):1245–56. 24. Davis E, Teng H, Bilican B, Parker MI, Liu B, Carriera S, Goding CR, Prince S. Ectopic Tbx2 expression results in polyploidy and cisplatin resistance. Oncogene. 2008;27(7):976–84. 25. Lane AA, Chabner BA. Histone deacetylase inhibitors in cancer therapy. J Clin Oncol. 2009;27(32):5459–68.