Plant Cell Rep (2011) 30:1393–1404 DOI 10.1007/s00299-011-1048-4
ORIGINAL PAPER
Isolation and characterization of fatty acid desaturase genes from peanut (Arachis hypogaea L.) Xiaoyuan Chi • Qingli Yang • Lijuan Pan Mingna Chen • Yanan He • Zhen Yang • Shanlin Yu
•
Received: 8 November 2010 / Revised: 27 January 2011 / Accepted: 28 February 2011 / Published online: 16 March 2011 Ó Springer-Verlag 2011
Abstract Fatty acid desaturases are responsible for the insertion of double bonds into pre-formed fatty acid chains in reactions that require oxygen and reducing equivalents. In this study, genes for FAB2, FAD2-2, FAD6 and SLD1, were cloned from peanut (Arachis hypogaea L.). The ORFs of the four genes were 1,221, 1,152, 1,329 and 1,347 bp in length, encoding 406, 383, 442 and 448 amino acids, respectively. The predicted amino acid sequences of AhFAB2, AhFAD2-2, AhFAD6, AhSLD1 shared high sequence identity of 79, 76.2, 73.4 and 61% to the corresponding ones in Arabidopsis, respectively. Heterologous expression in yeast was used to confirm the regioselectivity and the function of AhFAD2-2 and AhFAD6. Linoleic acid (18:2), normally not present in wild-type yeast cells, was detected in transformants of these two genes. Quantitative real-time RT-PCR analysis indicated that the transcript abundances of AhFAB2 and AhFAD2-1 were higher in seed than that in other tissues examined. On the other hand, transcript of AhFAD2-2, AhFAD6 and AhSLD1 showed higher abundances in leaves. In addition, these five genes showed different expression patterns during seed development. These results indicated that the five genes may have different biochemical functions during vegetative growth and seed development.
Keywords Fatty acid desaturase Peanut (Arachis hypogaea L.) Phylogenetic analysis Quantitative real-time RT-PCR Saccharomyces cerevisiae Abbreviations FAB2 Stearoyl-ACP desaturase FAD2 Microsomal D12 desaturase FAD3 Microsomal x3 desaturase FAD4 Trans D3 desaturase FAD5 D7 desaturase FAD6 Plastidial D12 desaturase FAD7 Plastidial x3 desaturase FAD8 Plastidial x3 desaturase ADS D9 desaturase SLD1 Sphingolipid D8 desaturase DES1 Sphingolipid D4 desaturase D6D D6 desaturase DesC Cyanobacterial D9 desaturase DesA Cyanobacterial D12 desaturase DesB Cyanobacterial x3 desaturase
Introduction
Communicated by D. Zaitlin. X. Chi and Q. Yang are co-first authors. X. Chi Q. Yang L. Pan M. Chen Y. He Z. Yang S. Yu (&) Shandong Peanut Research Institute, Qingdao 266100, People’s Republic of China e-mail:
[email protected]
Vegetable oils have become increasingly important economically because they are renewable resources of highly reduced carbon and are widely used in diets and industrial applications (Yang and Xu 2007). Peanut (Arachis hypogaea L.) is an allotetraploid species (2n = 4x = 40, AABB) and one of the five most important oilseed crops cultivated worldwide (Chen et al. 2010). The peanut seed comprises around 50% oil, of which approximately 80% consists of oleic acids (36–67%) and linoleic acids
123
1394
(15–43%) (Moore and Knauft 1989). One of the major factors affecting the quality of peanut oil is the content of polyunsaturated fatty acids. Edible oils rich in oleic acid are suitable for human and animal consumption due to their improved stability, flavor and nutrition (Heppard et al. 1996). It would be of great importance to investigate the fatty acid biosynthesis to improve oil quality and increase oil content of peanut. Fatty acid desaturases are enzymes that introduce double bonds into the hydrocarbon chains of fatty acids, and play an essential role in fatty acid metabolism and the maintenance of biological membranes in living organisms (Singh et al. 2002). These desaturation processes take place in both the plastidial membrane and the endoplasmic reticulum (ER) membrane via two different pathways (Ohlrogge and Browse 1995). With better understanding of fatty acid metabolic pathway, many desaturase genes with different regioselectivities were cloned (Wakita et al. 2001; Thelen and Ohlrogge 2002; Anai et al. 2003; Nakamura et al. 2004; Peng et al. 2010). They belong to a large gene family, containing conserved histidine regions. Histidinerich boxes are thought to form a part of the diiron center where oxygen activation and substrate oxidation occur (Chi et al. 2008a, b). For higher plants, most information on the function and specificity of fatty acid desaturases had been obtained from the characterization of Arabidopsis mutants, which were deficient in specific desaturation activities (Somerville and Browse 1991). The desaturase genes detected in Arabidopsis were divided into several subfamilies. FAB2 was the only soluble desaturase characterized until now and catalyzed the desaturation of stearic acid (C18:0) to C18:1 in the acyl carrier protein (ACP)-bound form (Murphy and Piffanelli 1998). FAD2 and FAD6 were x6 desaturases that synthesized the dienoic fatty acid, linoleic acid (C18:2), from oleic acid (C18:1) in the endoplasmic reticulum (ER) and plastids, respectively. FAD3, FAD7 and FAD8 were x3 desaturases that synthesized linolenic acid (C18:3) from linoleic acid (C18:2) in the ER (FAD3) and plastids (FAD7 and FAD8), respectively (Gibson et al. 1994; Berberich et al. 1998). FAD4 and FAD5 produced C16:1 from C16:0 specifically for PG and MGDG, respectively (Murphy and Piffanelli 1998). ADS was D9 acyl-lipid desaturase that participated in desaturation at the D9 position of C16:0 in the ER (Fukuchi-Mizutani et al. 1998; Heilmann et al. 2004). SLD1 encoded a sphingolipid D8 desaturase that led to the accumulation of 8 (Z/ E)-C18-phytosphingenine in the leaves and roots of Arabidopsis plants (Sperling et al. 1998; Ryan et al. 2007). DES1 encoded the sphingolipid D4 desaturase responsible for the synthesis of D4-unsaturated LCBs
123
Plant Cell Rep (2011) 30:1393–1404
such as sphingosine and sphinga-4,8-dienine in Arabidopsis (Ternes et al. 2002; Michaelson et al. 2009). Two microsomal oleoyl-PC desaturase genes (AhFAD21A and AhFAD2-1B), each having its origin in different diploid progenitor species, have been isolated from the cultivated peanut (Jung et al. 2000b; Lopez et al. 2000). These two homeologous genes were expressed in normal oleate peanuts, but a G448A mis-sense mutation in AhFAD2-1A and a significant reduction in the level of AhFAD2-1B transcript together resulted in high oleate phenotype in peanut varieties (8–2122 and M2-225), and one expressed gene encoding a functional enzyme appeared to be sufficient for the normal oleate phenotype (Jung et al. 2000a). Patel et al. (2004) reported an insertion of the same miniature inverted-repeat transposable element (MITE) in AhFAD2-1B gene in a chemical-induced mutant Mycogen-Flavo and a previously characterized M2-225 mutant. This MITE insertion in AhFAD2-1B caused a frameshift, resulting in a putatively truncated protein. The insertion of this MITE in AhFAD2-1B, in addition to the point mutation in AhFAD2-1A, appeared to be the cause of the high-oleate phenotype in mutants Mycogen-Flavo and M2-225. Yu et al. (2008) reported that an extra A was inserted at the position ?442 bp of AhFAD2-1B sequence of radiation-induced high oleic acid genotypes, which resulted in the shift of open reading frame and a truncated protein. Yin et al. (2007) indicated that down-regulation of the FAD2-1 in peanut resulted in a 70% increase in oleic acid content in the seeds of transformed plants compared with a 37.93% increase in untransformed plants. Analysis of transcript level showed that the expression of AhFAD21B gene in high oleic acid genotype was slightly lower than that in normal genotype. Recently, detection of FAD2-1 alleles was achieved by a cleaved amplified polymorphic sequence (CAPS) marker for the A genome (Chu et al. 2007) and a real-time polymerase chain reaction (PCR) marker for the B genome (Barkley et al. 2010). Moreover, a simple PCR assay for detection of FAD2-1 alleles on both genomes was developed by designing allele-specific primers and altering PCR annealing temperatures (Chen et al. 2010). Varieties of fatty acids play crucial roles in plant physiology and possess high food and industrial values (Topfer et al. 1995). However, only limited kinds of fatty acid desaturase genes in peanut have been functionally validated until now. It remains unclear if other kinds of desaturase genes are present in peanuts. In the present study, we isolated four novel desaturase genes from peanut and demonstrated the functions of two genes by heterologous expression in yeast (Saccharomyces cerevisiae). Also, the expression patterns of these genes were investigated in different tissues and seed developmental stages.
Plant Cell Rep (2011) 30:1393–1404
1395
Materials and methods
Phylogenetic analysis
Plant materials
Amino acid sequences were aligned using ClustalX program with the implanted BioEdit (Thompson et al. 1994). The neighbor-joining (NJ) method in MEGA4 (Tamura et al. 2007) was used to construct the phylogenetic tree. Bootstrap with 1,000 replicates was used to establish the confidence limit of the tree branches. Default program parameters were used.
Peanut seeds (Arachis hypogaea L. cultivar Huayu19) were sown in sand and soil mixture (1:1), grown in a growth chamber under a 16- and 8-h light–dark cycle at 26°C and 22°C, respectively. Three kinds of 12-day-old tissues including roots, stems and leaves were collected as experimental materials for quantitative real-time RT-PCR analysis. In addition, immature peanut seeds 25 to 60 days after pegging (DAP) were also collected for expression analysis. Nucleic acid manipulation Total RNA was extracted from samples using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. Before cDNA synthesis, RNA was treated with RQ1 RNase-free DNaseI (Promega, WI, USA) according to the manufacturer’s instructions to ensure no DNA contamination, and then the first-strand cDNA synthesis was carried out with approximately 5 lg RNA using an RT-PCR kit (Promega, WI, USA) according to the manufacturer’s procedure. Full-length cDNA sequence isolation PCR was performed with the LA PCR system (TaKaRa) using 2.5 ll of 109 PCR buffer with MgCl2, 1 ll of 10 lM of each primer, 4.0 ll of 10 mM dNTPs, 1 ll cDNA samples, 0.5 ll LA TaqTM DNA polymerase and 15 ll double distilled water. The PCR products were run on 1% agarose gel and purified with Gel Extraction Kit (Takara) according to the manufacturer’s protocol. The purified products were then cloned into the pMD18-T Easy vector (Takara) and sequenced (Shangon, Shanghai). Sequence analysis Open reading fragment (ORF) and encoded amino acid sequence of genes were deduced by BioXM 2.6. Physicochemical properties of the deduced protein were predicted by Protparam (http://www.expasy.ch/tools/protparam.html). Active sites of the protein sequence were analyzed by PROSITE database. The putative subcellular localizations of the candidate proteins were estimated by TargetP (http:// www.cbs.dtu.dk/services/TargetP/) and Predotar (http:// urgi.versailles.inra.fr/predotar/predotar.html). The potential N-terminal presequence cleavage site was predicted by ChloroP (http://www.cbs.dtu.dk/services/ChloroP/).
Quantitative real-time RT-PCR The real-time RT-PCR analysis was performed using a LightCycler 2.0 instrument system (Roche, Germany). b-actin gene was taken as the reference gene. Six pairs of gene-specific primers (Table 1) were designed according to the AhFAB2 cDNA (qFAB2-F and qFAB2-R), AhFAD2-1 (qFAD2-1-F and qFAD2-1-R), AhFAD2-2 (qFAD2-2-F Table 1 DNA sequences of oligonucleotide primers used in this study Name
Oligonucleotide sequence 50 –30
Full-length cDNA sequence cloning FAB2-F
ATGGCTCTGAGGCTGAAC
FAB2-R
TTAGAGTTGCACTTCCCTAT
FAD2-2-F1
ATGGGAGCTGGCGGCCGA
FAD2-2-R1
TCACAACTTATTGTTGTACCAGAATAC
FAD6-F1
ATGGCTTGCAGGCTTGCAG
FAD6-R1
TCAGGCATAATCAGGCATGACT
SLD1-F
ATGGCGGAACCACAATCAA
SLD1-R
TCATCCATGAGTGTTAACAGCTTC
Real-time RT-PCR qActin-F
TTGGAATGGGTCAGAAGGATGC
qActin-R
AGTGGTGCCTCAGTAAGAAGC
qFAB2-F
CGGTTAGGTCTGCCACCTTC
qFAB2-R
ACGCCACGAGACTGCATACA
qFAD2-1-F qFAD2-1-R
ATTCAAACCCTCCATTCAGTGTTG GTGGTGGCAATGTAGAAGAGTAAG
qFAD2-2-F
CCTCACACTCACTATTACCCTCAC
qFAD2-2-R
TGACAAGACGGATAAGACCATAGG
qFAD6-F
TCCATATTCCGCACCACATATCC
qFAD6-R
TTGTCTTCATCAGTCTCCAGTTCC
qSLD1-F
TCTTGATGTGAGTTGTTCTTCTTGG
qSLD1-R
GCGTCCGAATCGTGAGAGC
Yeast expression FAD2-2-F2
TAGGATCCAAAATGGGAGCTGGCGGC
FAD2-2-R2
GGCCTCGAGTCACAACTTATTGTTGTA
FAD6-F2
TAGGATCCAAAATGGCTTGCAGGCTTG
FAD6-R2
TAACTCGAGTCAGGCATAATCAGGCAT
123
1396
Plant Cell Rep (2011) 30:1393–1404
and qFAD2-2-R), AhFAD6 (qFAD6-F and qFAD6-R), AhSLD1(qSLD1-F and qSLD1-R) and b-actin (qActin-F and qActin-R) sequences. The real-time RT-PCR reactions were performed using the SYBR Premix Ex Taq polymerase (TaKaRa, Japan) according to the manufacturer’s instructions. Each 20 ll reaction comprised 2 ll template, 10 ll 29 SYBR Premix and 0.4 ll (200 nM) of each primer. The reactions were subjected to an initial denaturation step of 95°C/10 s, followed by 40 cycles of 95°C/5 s, 60°C/30 s and 72°C/10 s. A melting curve analysis was performed at the end of the PCR run over the range 60–95°C, increasing the temperature stepwise by 0.5°C every 10 s. Baseline and quantification cycle (CP) were automatically determined using the LightCycler Software. Zero template controls were included for each primer pair, and each PCR reaction was carried out in triplicate. CP values were converted into relative quantities via the delta-CP method using the sample with the lowest CP as calibrator. Expression in S. cerevisiae The auxotrophic S. cerevisiae strain INVSc1 (MATa his3D1 leu2 trp1-289 ura3-52) and the high copy number shuttle vector pYES2 were used for analyzing expression of recombinant proteins (Invitrogen). The coding regions of AhFAD2-2 and AhFAD6 were amplified separately using specific primers with BamHI or XhoI restriction site
Table 2 Fatty acid desaturase genes in peanut
Fatty acid analysis Total lipids were extracted with dichloromethane/methanol (2:1) from dried cells, solidified under nitrogen gas ventilation and transmethylated with methanol containing 0.5 M KOH–methanol/H2O (95:5) at 100°C for 2 h. The fatty acid methyl esters (FAMEs) were recovered with n-hexane. FAMEs analysis was carried out using a Finnigan Trace GC–MS equipped with a 30 m 9 0.25 mm DB-5 ms capillary column. Fatty acids were identified by comparing their retention times with those of their FAME standards (Sigma Chemicals Co., USA) separated on the same GC. Measurements were done using peak height area integrals expressed
Protein
Accession
Len (aa)
50 upstream region (bp)
30 downstream region (bp)
Molecular mass (kDa)
PI
FAB2
FJ230310
406
19
259
46.2516
6.24
FAD2-2
FJ768732
383
97
247
43.8292
8.8
FAD6
FJ768730
442
96
264
51.642
9.09
SLD1
FJ824607
448
17
433
51.3642
9.06
Fig. 1 Alignment of the complete deduced amino acid sequences of stearoyl-ACP desaturase genes. The conserved histidine motifs are highlighted in black boxes. GenBank accession numbers are as
123
(underlined). The amplified AhFAD2-2 and AhFAD6 genes were digested by BamHI and XhoI, connected to the plasmid pYES2 dual digested with the same restriction enzymes, which were located between the inducible yeast GAL1 promoter and the yeast CYC1 terminator, respectively. The constructs pYFAD2-2 and pYFAD6, as well as the pYES2 control, were transformed into the INVSc1 cells using a lithium acetate method (Gietz et al. 1995). Transformants were selected on minimal medium plates lacking uracil (SC-Ura). The yeast cells at logarithmic phase were incubated at 25°C for 48 h. The cells were harvested by centrifugation and washed three times with sterile distilled water and then dried by lyophilization.
follows: Arachis hypogaea (AhFAB2, FJ230310), Glycine max (GmFAB2, AAX86050), Arabidopsis thaliana (AtFAB2, NP_181899)
Plant Cell Rep (2011) 30:1393–1404
1397
Fig. 2 Alignment of the complete deduced amino acid sequences of membrane desaturase genes. The conserved motifs are highlighted in black boxes. GenBank accession numbers are as follows: Arachis hypogaea (AhFAD2-1A, AAB84262; AhFAD2-1B, AAF82293; AhFAD2-2, FJ768732; AhFAD6, FJ768730; AhSLD1, FJ824607),
Glycine max (GmFAD2-1A, AAX29989; GmFAD2-1B, ABF84062; GmFAD2-2, BAD89862; GmFAD6, P48628), Arabidopsis thaliana (AtFAD2, NP_187819; AtFAD6, NP_194824; AtSLD1, NP_191717), Stylosanthes hamata (ShSLD1, ABU98945)
as a percentage of the total of all integrals. The experiment was carried out in triplicate, and the data subjected to analysis of variance using DPS software (Zhejiang University,
China) Version 7.05. Duncan’s multiple range test was employed to determine the statistical significance (P \ 0.05) of the differences between the means.
123
1398
Plant Cell Rep (2011) 30:1393–1404
Fig. 3 Neighbor-joining tree based on the deduced amino acid sequences of stearoyl-ACP desaturase homologs. Sequences are shown by their accession numbers, strain names and labels. Bootstrap values from neighbor-joining analyses are listed to the left of each node and with values more than 50 are shown
Results and discussion Isolation of fatty acid desaturase genes from peanut Four fatty acid desaturase genes namely stearoyl-ACP fatty acid desaturase (FAB2), microsomal D12 fatty acid desaturase (FAD2-2), plastidial D12 fatty acid desaturase (FAD6) and sphingolipid D8 desaturase (SLD1) were isolated from peanut seedling, respectively. Three of them were identified from a peanut seedling full-length cDNA library and one was cloned via reverse transcription polymerase chain reaction (RT-PCR) and RACE (Rapid Amplification of cDNA Ends) method. The ORF of the four genes were 1,218, 1,149, 1,326 and 1,344 bp in length, encoding 406, 383, 442 and 448 amino acids, respectively (Table 2). Prediction of subcellular location by two programs, TargetP Server and Predotar, suggested that AhFAB2 and AhFAD6 protein were probably located in the chloroplast. The first 65 or 27 amino acids at the N-terminal end of the deduced protein for AhFAB2 or AhFAD6 had a high proportion of hydroxylated and small, hydrophobic amino acids, which was typical of chloroplast transit peptide. A Blast search revealed that the primary structure of AhFAB2, AhFAD2-2, AhFAD6, AhSLD1 shared high sequence identity of 79, 76.2, 73.4 and 61% to the corresponding ones in Arabidopsis, respectively. The amino acid sequence deduced from AhFAD2-2 showed 87% identity to that of the soybean FAD2-2, and 86% identity to soybean FAD2-3. The AhFAD2-1(AhFAD2-1A and AhFAD2-1B) and AhFAD2-2 were 75.1% identical in this study, compared with 72.5% (GmFAD2-1A and GmFAD2-2) and 70.5% (GmFAD2-1B and GmFAD2-2) in Glycine max. The four desaturase genes contained typical histidinerich boxes (Figs. 1, 2), which was in accordance with the standard of different types of desaturase genes. For example, two histidine boxes of AhFAB2 gene were consistent with those of plastidial stearoyl-ACP desaturases, which were represented as EENRHG, DEKRHE. Three histidine boxes of the AhFAD6 gene matched the standard for plastidial D12 desaturase, i.e., GHDCXH, HX2HH and
123
HXPHH. The third histidine box of AhSLD1 contained a His to Gln substitution at the third histidine residue, which was also evident in several fatty acid desaturases such as the borage D6 desaturase and all the sphingolipid desaturases thus characterized (Sperling et al. 1998; Sayanova et al. 2001). Also, in common with other desaturases of this type, AhSLD1 encoded a protein with a cytochrome b5-like haem-binding domain at the N-terminus. The presence of this binding domain was characterized by the His-Pro-GlyGly motif, which indicated that this putative desaturase existed as a fusion protein. Phylogenetic analysis The polyunsaturated fatty acids are synthesized by two distinct pathways in plants, known as the prokaryotic and eukaryotic pathways, which are located within the membrane of the plastid and the endoplasmic reticulum, respectively (Sato and Moriyama 2007). Therefore, plant desaturases fall into two major classes: soluble and membrane-bound desaturases. The soluble desaturases are analyzed separately from membrane-bound desaturases because they are restricted to higher plants and show no evolutionary relationship with the more widely distributed membrane desaturases (Shanklin and Cahoon 1998). To examine the relationships among different sources of desaturase genes, the neighbor-joining method was used to construct the phylogenetic trees and all tree topologies were highly congruent (Figs. 3, 4). The plant stearoyl-ACP desaturase is the only soluble desaturase identified to date. In contrast, all other desaturases identified in plants, algae, animals and fungi are integral membrane proteins (Singh et al. 2002; Yang et al. 2005). The phylogenetic tree indicated that AhFAB2 was grouped with stearoyl-ACP desaturases of higher plants and distinct from those of green algae (Fig. 3). It might suggest that stearoyl-ACP desaturases in green algae and higher plants arose by independent gene duplication events. As shown in the phylogenetic tree, all of the membranebound desaturases fell into three distinct subfamilies: D7/ D9 desaturase subfamily, D12/x3 desaturase subfamily and
Plant Cell Rep (2011) 30:1393–1404
1399
Fig. 4 Neighbor-joining tree based on the deduced amino acid sequences of membrane desaturases. Sequences are shown by their accession numbers (locus tags), strain names and labels. Bootstrap
values from neighbor-joining analyses are listed to the left of each node and values more than 50 are shown
‘front-end’ desaturase subfamily (Fig. 4). Based on functional criteria and the position of the clade integrated by D9 desaturases, D9 desaturase is assumed to be the ancestor of the remaining desaturases (Alonso et al. 2003). The D7/D9 -homologous genes of higher plants were grouped with D7 homologs of green algae, while the genes of cyanobacteria were placed in a basal position. Therefore, the D9 desaturase may arise by independent gene duplication events in plant and green algae branches, and the cyanobacterial D9
desaturase was identified as the origin of plant/green algae D7/D9 desaturase. In the D12/x3 desaturase subfamily, the AhFAD6 gene, grouped to chloroplastic D12 desaturase of higher plants, was situated along with D12 desaturases of cyanobacteria and green algae at the basal position of the tree. The microsomal D12 desaturases of higher plants formed a group and set apart from enzymes of green algae. The AhFAD2-1A and AhFAD2-1B genes clustered with FAD2-1
123
1400
Plant Cell Rep (2011) 30:1393–1404
Fig. 5 Expression analysis of five desaturase genes using quantitative real-time RT-PCR (RT-qPCR). The relative mRNA abundance was normalized with respect to the peanut actin gene. The bars are standard deviations (SD) of three technical repeats
genes of higher plants; whereas AhFAD2-2 gene clustered with FAD2-2 and FAD2-3 genes of higher plants. Besides, the x3 desaturases of cyanobacteria were placed in a basal position, grouped with both microsomal and chloroplastic x3 desaturases of higher plants and green algae. Therefore, it can be speculated that the cyanobacterial D12 desaturase might be the origin of the plant D12 and x3 desaturases, including both chloroplast and endoplasmic reticulum (ER) isozymes. The ‘front-end’ desaturases (D6 and sphingolipid D8 desaturases) formed a separate clade (Fig. 4). The sphingolipid D8 desaturase (AhSLD1) of peanut clustered with those of higher plants, forming a group with D6 desaturases of higher plants.
123
Quantitative real-time PCR analysis Quantitative real-time PCR (qRT-PCR) was employed to confirm the expression patterns of the four novel genes, as well as AhFAD2-1 (AhFAD2-1A and AhFAD2-1B), in four peanut tissues and at different developmental stages of seeds. b-actin was used as an internal reference control for total RNA input. Two microsomal oleoyl-PC desaturase genes (AhFAD2-1A and AhFAD2-1B) have been identified in peanut (Jung et al. 2000b). The open reading frames (ORFs) for FAD2-1A and FAD2-1B were 99% identical, encoding 379 amino acids with no introns in the coding sequence (Jung et al. 2000b; Lopez et al. 2000). In our analysis, the gene-specific primers used for amplification of
Plant Cell Rep (2011) 30:1393–1404
1401
Table 3 Comparison of fatty acid distribution of peanut in four different tissues Fatty acid
Fatty acid distribution (percent of total by mass) Roots
Stems
Leaves
Seeds 25 DAP
32 DAP
39 DAP
46 DAP
53 DAP
60 DAP
C12:0
0.075
0.049
0.041
–
–
–
–
–
–
C14:1D9
–
–
–
0.009 a
0.016 b
0.015 b
0.016 b
0.016 b
0.010 a
C14:0 C15:1D10
0.347 –
0.238 –
0.135 –
0.009 a –
0.016 b 0.002 a
0.015 b 0.001 a
0.016 b 0.001 a
0.016 b –
0.011 a 0.001 a
C15:0
0.443
0.101
0.032
–
0.001 a
0.001 a
0.002 a
–
0.001 a
C16:1D9
0.178
0.02
0.418
–
–
–
–
–
–
33.66
22.886
9.282 ab
9.6 a
9.291 ab
8.516 c
8.876 bc
7.890 d 0.009 b
C16:0 D10
34.66
C17:1
–
–
–
–
–
–
0.005 a
0.006 a
C17:0
0.23
0.127
0.077
0.009 a
0.027 b
0.024 b
0.031 b
0.031 b
0.035 b
C18:2D9,12
34.197
40.352
17.254
18.633 d
19.883 b
19.363 c
18.662 d
20.234 a
18.506 d
C18:1D9
63.91 c
24.198
20.356
55.105
64.387 bc
63.132 d
66.077 a
64.701 b
65.544 a
C18:0
2.21
3.141
3.269
2.787 a
2.593 a
2.789 a
3.338 b
3.228 b
4.476 c
C19:0
–
–
–
0.253 ab
0.261 a
0.223 abc
0.245 abc
0.214 bc
0.206 c
C20:1
–
–
–
0.519 a
0.565 a
0.523 a
0.365 b
0.338 b
0.383 b
C20:0
0.338
0.46
0.235
1.076 a
1.036 a
1.015 ab
0.976 ab
0.868 b
1.135 a
C22:0
0.979
0.291
0.211
2.447 a
2.197 a
2.199 a
1.304 b
1.104 b
1.294 b
C23:0
0.422
0.091
0.035
–
–
–
–
–
–
C24:0
1.722
1.115
0.302
0.588 a
0.67 a
0.631 a
0.445 bc
0.369 c
0.499 b
D11
Numbers with different letters are statistically significant (P \ 0.05) Dashes indicate that the fatty acid was not detected. In the same row, the fatty acid alterations at six seed developmental stages are compared to each other
AhFAD2-1 recognized and amplified both AhFAD2-1A and AhFAD2-1B genes. As shown in Fig. 5, these five genes displayed specific spatial expression patterns across different tissues. The AhFAB2 gene was expressed most strongly in seeds followed by leaves, and weakly in roots and stems. The AhFAD2-2 gene showed the highest mRNA abundance in leaves compared with the other three tissues, whereas the expression of AhFAD2-1 gene was largely restricted to seeds. Both AhFAD6 and AhSLD1 genes exhibited the highest transcript accumulation in leaves, whereas AhSLD1 had relatively higher expression in stem and AhFAD6 was preferentially expressed in seed. The expression patterns of the five desaturase genes across six developmental stages of seeds are also illustrated in Fig. 5. AhFAB2 and AhFAD2-1 RNAs were presented in high abundance across all stages compared with those of AhFAD6 and AhFAD2-2, which were less abundant; whereas AhSLD1 transcript was relatively rare and near the detection limit. AhFAB2 and AhFAD6 shared similar expression behaviors over the developmental stages with high expressions at 25 and 39 DAPs and much lower levels at other stages. AhFAD2-1 and AhFAD2-2 reached a maximum expression level at 25 DAP and decreased thereafter. In contrast, AhSLD1 remained relatively high at
the initial three stages, but showed dramatic decrease in abundance during later stages. Fatty acid composition of the different peanut plant tissues and seed developmental stages The relationship between the accumulation of transcripts of five desaturase genes with the distribution of fatty acids among different peanut tissues was investigated. To that end, the fatty acid compositions of different plant tissues used in the expression analysis (roots, stems, leaves, and seeds) were analyzed. The fatty acid composition of peanut seeds has been analyzed in the past by many other groups. However, other tissues like stems or roots have not been analyzed in detail. As shown in Table 3, the major fatty acid compositions of peanut were C16:0, C18:0, C18:1D9, C18:2D9,12, C20:0 and C24:0. C18:1D9 and C18:2D9,12 represented more than 80% of the total fatty acids in seeds compared to approximately 60% in other tissues. A higher amount of dienoic fatty acid (linoleic acid, 18:2) was observed in roots and stems, whereas monoenoic fatty acid (oleic acid, 18:1) was the most abundant detected in leaves and seeds. In seed, the C16:0 levels reached 9%, which
123
1402
Plant Cell Rep (2011) 30:1393–1404
Fig. 6 GC of FAME of recombinant yeast harboring pYES2 (control, a), pYFAD2-2 (b) and pYFAD6 (c). The transformants at logarithmic phase were grown for 48 h at 25°C, and FAMEs from whole cells were prepared and analyzed by gas chromatography (GC) as indicated in ‘‘Materials and methods’’. The experiment was repeated in triplicate and the results of a representative experiment are shown
means a reduction of about 60% with respect to its levels detected in other tissues. In addition, it was interesting that C16:1D9 was detected in roots, stems and leaves, but not in seeds. Moreover, fatty acid distributions at different developmental stages were analyzed in an attempt to find any linkage between fatty acids alteration and seed development. As shown in Table 3, no significant change was detected in C16:0 and C18:0 content at 39 days after pegging. The earliest time point reflecting an alteration occurred at 46 DAP, with the C18:0 content exhibiting a gradual increase and the C16:0 content exhibiting a gradual
123
decrease. It was evident that the change in the C18:1 content showed reverse trend compared to that of C18:2. For example, C18:1 content increased significantly at 46 DAP, whereas C18:2 content decreased at the same time course. AhFAB2 and AhFAD2-1 were the genes that were mainly expressed in seeds in high abundance compared with the other three. Although the transcript levels of these two genes were relatively low at 46 DAP, the decrease of transcript accumulation for AhFAD2-1 gene was larger than that of AhFAB2 (Fig. 5). These results indicated that the increase of C18:1 content appeared to be due to the reduced flux to C18:2 fatty acid.
Plant Cell Rep (2011) 30:1393–1404
1403
Conclusion
Table 4 Fatty acid composition of transformed S. cerevisiae Transformant
Percent of total fatty acids 16:0
16:1
16:2
18:0
18:1
18:2
pYES2
18.42 a
43.83 a
–
5.01 a
28.2 a
–
pYFAD2-2
22.68 b
42.78 b
–
6.67 b
20.57 b
5.34 a
pYFAD6
19.54 c
41.38 c
–
5.66 a
28.4 a
0.1 b
In the same column, numbers with different letters are statistically significant (P \ 0.05) Dashes indicate that the fatty acid was not detected
Functional analysis in S. cerevisiae Heterologous expression in yeast was used to confirm D12 regioselectivity and function of AhFAD2-2 and AhFAD6 genes. pYFAD2-2, pYFAD6 and empty vector, pYES2 (control), were transformed into S. cerevisiae INVSc1. The total lipids of the transformants were subjected to GC–MS analysis. The results showed a novel fatty acid peak for pYFAD2-2 and pYFAD6, which was absent for the control (Fig. 6). The novel fatty acid was designated as C18:2 in comparison to the retention time of FAME standard mixtures (Sigma). No C16:2 was detected, indicating that AhFAD2-2 and AhFAD6 recognized only one substrate (C18:1) in yeast (Table 4). This was consistent with the recent reports in which D12-FADs from the Rhizopus arrhizus (Wei et al. 2004) and Chlorella vulgaris (Lu et al. 2009, 2010) recognized only one substrate (C18:1) in yeast. Conversely, D12-FADs from Phaeodactylum tricornutum (Domergue et al. 2003), Sapium sebiferum (Niu et al. 2007) and Chlorella C-27 (Suga et al. 2002) were found to recognize two substrates (C16:1 and C18:1), while C18:1 was the preferred substrate. But the percentage of C18:2 was different, with 5.96% for pYFAD2-2 and 0.1% for pYFAD6. In addition, the function of AhFAD2-1B gene was validated by the expression in S. cerevisiae, and the content of C18:2 in the strain containing pYFAD2-1B was 9.8% of the total fatty acids in yeast (Yu et al. 2008). These data showed that the activity of the AhFAD6 protein was significantly lower than that of AhFAD2-1B and FAD2-2 protein in yeast. Yeast is known to be the model of choice for the functional characterization of microsomal FADs, because it contains a short electron transport system required by these desaturases (i.e., cytochrome b5 and NADH-cytochrome b5 reductase) (Domergue et al. 2003). Nevertheless, the low desaturation level evident from Fig. 6C suggested that desaturases of plastidial origin, which usually required ferredoxin and NADPH-ferredoxin reductase, were supplied to some extent with reducing equivalents in yeast cells.
In the present study, five desaturase genes from peanut, AhFAB2, AhFAD2-1, AhFAD2-2, AhFAD6 and AhSLD1, were analyzed. Moreover, the function of AhFAD2-2 and AhFAD6 genes were verified by heterologous expression in S. cerevisiae. This study provides new insights into the origin and evolution of fatty acid biosynthesis pathways in higher plants. Additionally, the characterization of desaturases from peanut will provide additional candidate genes for the production of nutritionally important fatty acids in transgenic plants. Acknowledgments This work was supported by a grant from Modern Agro-industry Technology Research System (nycytx-19), National High-Tech Research and Development Plan of China (2006AA10A114; 2007AA10Z189), National Project of Scientific and Technical Supporting Program (2008BAD97B04), the National Natural Science Foundation of China (31000728) and the Natural Science Fund of Shangdong Province (ZR2009DQ004).
References Alonso DL, Maroto FG, Ruiz JR, Garrido JA, Vilches MA (2003) Evolution of the membrane-bound fatty acid desaturases. Biochem Syst Ecol 31:1111–1124 Anai T, Koga M, Tanaka H, Kinoshita T, Rahman SM, Takagi Y (2003) Improvement of rice (Oryza sativa L.) seed oil quality through introduction of a soybean microsomal omega-3 fatty acid desaturase gene. Plant Cell Rep 21:988–992 Barkley NA, Chenault-Chamberli KD, Wang ML, Pittman RN (2010) Development of a real time PCR genotyping assay to identify high oleic acid peanuts (Arachis hypogaea L.). Mol Breed 25:541–548 Berberich T, Harada M, Sugawara K, Kodama H, Iba K, Kusano T (1998) Two maize genes encoding x-3 fatty-acid desaturase and their differential expression to temperature. Plant Mol Biol 36:297–306 Chen ZB, Wang ML, Barkley NA, Pittman RN (2010) A simple allele-specific PCR assay for detecting FAD2 alleles in both A and B genomes of the cultivated peanut for high-oleate trait selection. Plant Mol Biol Rep 28:542–548 Chi X, Yang Q, Zhao F, Qin S, Yang Y, Shen J, Lin H (2008a) Comparative analysis of fatty acid desaturases in cyanobacterial genomes. Comp Funct Genomics. doi:10.1155/2008/284508 Chi X, Zhang X, Guan X, Ding L, Li Y, Wang M, Qin S (2008b) Fatty acid biosynthesis in eukaryotic photosynthetic microalgae: identification of a microsomal delta 12 desaturase in Chlamydomonas reinhardtii. J Microbiol 46:189–201 Chu Y, Ramos L, Holbrook CC, Ozias-Akins P (2007) Frequency of a loss-of-function mutation in oleoyl-PC desaturase (ahFAD2A) in the mini-core of the US peanut germplasm collection. Crop Sci 47:2372–2378 Domergue F, Spiekermann P, Lerchl J, Beckmann C, Kilian O, Kroth PG, Boland W, Za¨hringer U, Heinz E (2003) New insight into Phaeodactylum tricornutum fatty acid metabolism. Cloning and functional characterization of plastidial and microsomal D12fatty acid desaturases. Plant Physiol 131:1648–1660 Fukuchi-Mizutani M, Tasaka Y, Tanaka Y, Ashikari T, Kusumi T, Murata N (1998) Characterization of D9 acyl-lipid desaturase
123
1404 homologues from Arabidopsis thaliana. Plant Cell Physiol 39(2):247–253 Gibson S, Arondel V, Iba K, Somerville C (1994) Cloning of a temperature-regulated gene encoding a chloroplast x-3 desaturase from Arabidopsis thaliana. Plant Physiol 106:1615–1621 Gietz RD, Schiestl RH, Williems AR, Woods RA (1995) Studies on the transformation of intact yeast cells by the LiAc/SSDNA/PEG procedure. Yeast 11:355–360 Heilmann I, Pidkowich MS, Girke T, Shanklin J (2004) Switching desaturase enzyme specificity by alternate subcellular targeting. Proc Natl Acad Sci USA 101(28):10266–10271 Heppard EP, Kinney AJ, Stecca KL, Miao GH (1996) Developmental and growth temperature regulation of two different microsomal x-6 desaturase genes in soybeans. Plant Physiol 110:311–319 Jung S, Powell G, Moore K, Abbott A (2000a) The high oleate trait in the cultivated peanut (Arachis hypogaea L.). II. Molecular basis and genetics of the trait. Mol Gen Genet 263:806–811 Jung S, Swift D, Sengoku E, Patel M, Teule´ F, Powell G, Moore K, Abbott A (2000b) The high oleate trait in the cultivated peanut (Arachis hypogaea L.). I. Isolation and characterization of two genes encoding microsomal oleoyl-PC desaturases. Mol Gen Genet 263:796–805 Lopez Y, Nadaf HL, Smith OD, Connell JP, Reddy AS, Fritz AK (2000) Isolation and characterization of the delta(12)-fatty acid desaturase in peanut (Arachis hypogaea L.) and search for polymorphisms for the high oleate trait in Spanish market-type lines. Theor Appl Genet 101:1131–1138 Lu Y, Chi X, Yang Q, Li Z, Liu S, Gan Q, Qin S (2009) Molecular cloning and stress-dependent expression of a gene encoding D12fatty acid desaturase in the Antarctic microalga Chlorella vulgaris NJ-7. Extremophiles 13:875–884 Lu Y, Chi X, Li Z, Yang Q, Li F, Liu S, Gan Q, Qin S (2010) Isolation and characterization of a stress-dependent plastidial D12 fatty acid desaturase from the Antarctic microalga Chlorella vulgaris NJ-7. Lipids 45:179–187 Michaelson LV, Za¨uner S, Markham JE, Haslam RP, Desikan R, Mugford S, Albrecht S, Warnecke D, Sperling P, Heinz E, Napier JA (2009) Functional characterization of a higher plant sphingolipid D4-desaturase: defining the role of sphingosine and sphingosine-1-phosphate in Arabidopsis. Plant Physiol 149:487–498 Moore KM, Knauft DA (1989) The inheritance of high-oleic acid in peanut. J Hered 80:252–253 Murphy DJ, Piffanelli P (1998) Fatty acid desaturases: structure, mechanism and regulation. In: Harwood HL (ed) Plant lipid biosynthesis. Cambridge University Press, Cambridge, pp 95–130 Nakamura MT, Cheon Y, Li Y, Nara TY (2004) Mechanisms of regulation of gene expression by fatty acids. Lipids 39:1077–1083 Niu B, Ye H, Xu Y, Wang S, Chen P, Peng S, Ou Y, Tang L, Chen F (2007) Cloning and characterization of a novel D12-fatty acid desaturase gene from the tree Sapium sebiferum. Biotechnol Lett 29:959–964 Ohlrogge J, Browse J (1995) Lipid biosynthesis. Plant Cell 7:957–970 Patel M, Jung S, Moore K, Powell G, Ainsworth C, Abbott A (2004) High-oleate peanut mutants result from a MITE insertion into the FAD2 gene. Theor Appl Genet 108:1492–1502 Peng Q, Hu Y, Wei R, Zhang Y, Guan C, Ruan Y, Liu C (2010) Simultaneous silencing of FAD2 and FAE1 genes affects both oleic acid and erucic acid contents in Brassica napus seeds. Plant Cell Rep 29:317–325 Ryan PR, Liu Q, Sperling P, Dong B, Franke S, Delhaize E (2007) A higher plant D8 sphingolipid desaturase with a preference for (z)-
123
Plant Cell Rep (2011) 30:1393–1404 isomer formation confers aluminum tolerance to yeast and plants. Plant Physiol 144:1968–1977 Sato N, Moriyama T (2007) Genomic and biochemical analysis of lipid biosynthesis in the unicellular Rhodophyte Cyanidioschyzon merolae: lack of a plastidic desaturation pathway results in the coupled pathway of galactolipid synthesis. Eukaryotic Cell 6:1006–1017 Sayanova O, Beaudoin F, Libisch B, Castel A, Shewry PR, Napier JA (2001) Mutagenesis and heterologous expression in yeast if a plant D6 fatty acid desaturase. J Exp Bot 52:1581–1585 Shanklin J, Cahoon EB (1998) Desaturation and related modifications of fatty acids. Annu Rev Plant Physiol Plant Mol Biol 49:611–641 Singh SC, Sinha RP, Ha¨der DP (2002) Role of lipids and fatty acids in stress tolerance in cyanobacteria. Acta Protozool 41:297–308 Somerville C, Browse J (1991) Plant lipids: metabolism mutants and membranes. Science 252:80–87 Sperling P, Zahringer U, Heinz E (1998) A sphingolipid desaturase from higher plants. Identification of a new cytochrome b5 fusion protein. J Biol Chem 273:28590–28596 Suga K, Honjoh K, Furuya N, Shimizu H, Nishi K, Shinohara F, Hirabaru Y, Maruyama I, Miyamoto T, Hatano S, Iio M (2002) Two low-temperature-inducible Chlorella genes for delta12 and omega-3 fatty acid desaturase (FAD): isolation of delta12 and omega-3 fad cDNA clones, expression of delta12 fad in Saccharomyces cerevisiae, and expression of omega-3 fad in Nicotiana tabacum. Biosci Biotechnol Biochem 66:1314–1327 Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599 Ternes P, Franke S, Za¨hringer U, Sperling P, Heinz E (2002) Identification and characterization of a sphingolipid D4-desaturase family. J Biol Chem 277(28):25512–25518 Thelen JJ, Ohlrogge JB (2002) Metabolic engineering of fatty acid biosynthesis in plants. Metab Eng 4:12–21 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680 Topfer R, Martini N, Schell J (1995) Modification of plant lipid synthesis. Science 268:681–686 Wakita Y, Otani M, Hamada T, Mori M, Iba K, Shimada T (2001) A tobacco microsomal x-3 fatty acid desaturase gene increases the linolenic acid content in transgenic sweet potato (Ipomoea batatas). Plant Cell Rep 20:244–249 Wei DS, Li MC, Zhang XX, Ren Y, Xing LJ (2004) Identification and characterization of a novel D12-fatty acid desaturase gene from Rhizopus arrhizus. FEBS Lett 573:45–50 Yang MF, Xu YN (2007) Oleate accumulation, induced by silencing of microsomal omega-6 desaturase, declines with leaf expansion in transgenic tobacco. J Plant Physiol 164:23–30 Yang L, Chen J, Huang C, Liu Y, Jia S, Pan L, Zhang D (2005) Validation of a cotton-specific gene, Sad1, used as an endogenous reference gene in qualitative and real-time quantitative PCR detection of transgenic cottons. Plant Cell Rep 24:237–245 Yin DM, Deng SZ, Zhan KH, Cui DQ (2007) High-oleic peanut oils produced by HpRNA-mediated gene silencing of oleate desaturase. Plant Mol Biol Rep 25:154–163 Yu SL, Pan LJ, Yang QL, Min P, Ren ZK, Zhang HS (2008) Comparison of the D12 fatty acid desaturase gene between higholeic and normal-oleic peanut genotypes. J Genet Genomics 35:1–7