DOI: 10.2478/s11535-007-0011-4 Research article CEJB 2(1) 2007 71–86

Changes in cytokine production and morphology of murine lymphoma NK/Ly cells in course of tumor development Rostyslav R. Panchuk, Natalia M. Boiko, Maxim D. Lootsik, Rostyslav S. Stoika∗ Institute of Cell Biology, National Academy of Sciences of Ukraine, 79005, Lviv, Ukraine

Received 9 November 2006; accepted 15 February 2007 Abstract: The main goal of this study was to evaluate if specific cytokine expression in the NK/Ly lymphoma cells might be involved in development of intoxication in the tumor-bearing animals. RT-PCR analysis was used to study an expression of mRNA coding for IL-1α, IL-6, TNF-α, TNF-β and VEGF. ELISA was used to evaluate IL-6 and IFN-γ concentration in the ascitic fluid. Cytomorphological investigation of tumor cells was done after standard Romanovsky-Giemsa staining, and chromatin staining was performed with hematoxyline and neutral red. Lactate dehydrogenase and acid phosphatase release from tumor cells was estimated. It was revealed that the level of mRNA coding for VEGF and IL-6 was significant in the lymphoma cells. The level of VEGF mRNA was initially high and did not change during tumor progression, while the level of expression of IL6 mRNA was low at the initial stages of tumor growth and markedly increased (up to 5-fold) at the terminal stages. The obtained data on IL-6 mRNA expression were confirmed by ELISA, which showed more than 6-fold increase (from 90 to 570 pg/ml) in the IL-6 concentration in the ascitic fluid at late stages of NK/Ly tumor development. On the contrary to IL-6, concentration of IFN-γ in the ascitic fluid was very high at early stages of tumor development (1,000 pg/ml) and it markedly decreased (up to 30-fold, 30 pg/ml) at the terminal stages of tumor development. The high levels of IL-6 mRNA in tumor cells and IL-6 content in extracellular medium correlated with cell deterioration, as revealed by cytomorphologic study and the release of intracellular enzymes into extracellular medium. We suggest that an enhanced production and release of IL-6 by lymphoma cells can cause intoxication and exhaustion of the organism observed at terminal stages of tumor growth. c Versita Warsaw and Springer-Verlag Berlin Heidelberg. All rights reserved.  Keywords: Murine lymphoma NK/Ly, cytokines, tumor ageing

∗

E-mail: [email protected]

72

1

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

Introduction

The ascite murine tumor NK/Ly was introduced in 1960 by Nemeth and Kellner [1], and defined as lymphoma based on the morphological and clinical criteria. NK/Ly lymphoma originates from tumor cells, which evolved spontaneously in mice of the C3 line [1]. The ascite develops in 3-4 days after the intraperitoneal inoculation, and mice with transplanted lymphoma can then live for about 21-30 days. In addition to ascite development in the tumor-bearing mice, the foci of tumor infiltration in the mesenteric lymph nodes, liver, kidney, lung and other organs were usually observed. At late stages of NK/Ly lymphoma growth, a severe intoxication and loss of muscle mass in the tumor-bearing animals develops, which resembles cachectic effects observed during growth of some human tumors. The mechanisms of cachexia development in the NK/Ly lymphoma are not known. Cellular and sub-cellular changes taking place during growth and development of NK/Ly lymphoma were studied [2–4], however a role of cytokine expression during these processes is still not clear. The main goal of this study was to examine cytomorphological and molecular processes taking place in murine lymphoma NK/Ly cells at different stages of tumor development. We used RT-PCR method for measuring mRNA coding for five cytokines (IL-1α, IL-6, TNF-α, TNF-β and VEGF). Also, IL-6 and IFN-γ concentration in ascitic fluid was measured by ELISA at different drainages (from 1 to 3) of ascite. In parallel, cell size, distribution and their morphology were studied by light microscopy. A notable elevation in the IL-6 mRNA and protein was shown to accompany NK/Ly tumor ageing, which correlated with the manifestation of destructive processes in those lymphoma cells. The level of IFN-γ in the lymphoma cells considerably decreased during tumor ageing.

2

Materials and methods

2.1 Lymphoma passaging and measurement of body weight NK/Ly lymphoma was obtained from the tumor strain collection at R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, National Academy of Sciences of Ukraine, Kyiv. The ascite tumor was supported by the transfer of 0.2-0.3 ml of ascitic fluid (20-30 mln cells) from a donor mouse into the abdominal cavity of a recipient, non-inbred mouse. Ascite from the tumor-bearing mice was obtained and transplanted on the 8–9th day after the inoculation. The growth of the tumor was controlled by weighing the mice daily. The viability and number of cells of the ascitic fluid were checked by cell inspection using the haemocytometric chamber in the presence of 0.05% trypan blue dye. The lymphoma cell vitality in ascites used for transplantation was not less than 98%. Sampling of the ascite was performed on the 7-8th , 15-16th and 23-24th days after ascite inoculation. At the end of the experiment during autopsy, all animal organs were weighed. Special attention was given to the liver, spleen and brain weights, as well as to the carcass weight (animal body residue after elimination of inner organs, head, skin, tail and paws).

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

73

The study was performed in accordance with the guidelines of the Ethics Committee.

2.2 RT-PCR analysis RT-PCR analysis was used for evaluating the expression of mRNA coding for several cytokines. Total RNA was isolated from the NK/Ly cells using Trizol reagent (Sigma, USA). mRNA (A260 /A280 =1.8±0.1) was converted to cDNA using “RevertAidT M First Strand cDNA Synthesis Kit” (Fermentas, Lithuania). The obtained cDNAs were subjected to RT-PCR analysis using specific primers for murine cytokine cDNAs (Table 1). Gene

Primer

Sequence

IL-1α

forward reverse

5’-GCCAGTTGAGTAGGATAAAGG-3’ 5’-CAGTCTGTCTCCTTCTTGAGG-3’

IL-6

forward reverse

5’-TGGAGTCACAGAAGGAGTGGCTAAG-3’ 5’-TCTGACCACAGTGAGGAATGTCCAC-3’

TNF-α

forward reverse

5’-TCTCATCAGTTCTATGGCCC-3’ 5’-GGGAGTAGACAAGGTACAAC-3’

TNF-β

forward reverse

5’-CCCATCCACTCCCTCAGAAG-3’ 5’-CGCACTGAGGAGAGGCACAT-3’

VEGF

forward reverse

5’–GGAGATCCTTCGAGGAGCACTT–3‘ 5’–GGCGATTTAGCAGCAGATATAAGAA–3’

β-actin

forward reverse

5’-TCACCCACACTGTGCCCATCTA-3’ 5’-CAGCGGAACCGCTCATTGCCAA-3’

Table 1 Primers used in the study. Optimal conditions for RT-PCR analysis were chosen experimentally: the temperature was 94◦ , 55◦ and 72◦C (n=30) for cytokine cDNA, and 94◦ , 65◦ , 72◦ C, (n=25) for β-actin cDNA, used as a reference gene. It is known, that β-actin belongs to a family of housekeeping genes whose expression is assumed to be stable and does not differ in various types of cells. The DNA products of PCR reaction were resolved in 1% agarose gel, visualized by ethidium bromide, and photographed by an Olympus C-5000 digital camera. The DNA bands were evaluated quantitatively by using GelPro Analyzer 3.1 software.

2.3 ELISA ELISA kits for murine IL-6 and IFN-γ were purchased from eBioscience (San Diego, USA), and used according to the manufacturer’s instructions. The detection limit for IL-6 was 4 pg/ml, and 15 pg/ml for IFN-γ, according to ELISA Kit Manual. Measurements were performed in cell-free ascitic fluid and cytokine concentrations were normalized to cell number in the ascites (data presented in Supplementary Figures). Blood serum taken from intact mice was used as a control.

74

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

2.4 DNA fragmentation study of apoptotic cells DNA fragmentation was studied using agarose gel electrophoresis [5]. Briefly, 5 × 106 cells were pelleted and resuspended in 50 μl of 20 mM EDTA/50 mM Tris-HCl, pH 7.5, centrifuged for 5 min at 1,600 g and those pellets were resuspended in lysis buffer. SDS (final concentration 1%, Serva, Germany) and RNase A (final concentration 1 mg/ml, Sigma Chemical Co., St. Louis, USA) were added to each sample and then incubated for 1 h at 37◦ C. After that, proteinase K (final concentration 1 mg/ml, Boehringer Mannheim, Germany) was added to each sample then incubated for 1 h at 37◦ C. Then 10 M ammonia acetate (50% of the sample volume) was added to each sample and DNA was precipitated with 2 volumes of ice-cold iso-propanol at -20◦ C overnight. Samples were centrifuged for 30 min at 10 000 g, pellets were air dried, dissolved in TE buffer (10 μl/106 cells) and loaded into the dry wells of 1% (w/v) agarose gel. Electrophoresis was carried out in 1 mM EDTA/40 mM Tris-acetate buffer, pH 8.0, until the marker dye migrated 6-7 cm. Electrophoregrams were stained with ethydium bromide and screened in transilluminator under UV light and photographed by Olympus C-5000 digital camera.

2.5 Cytomorphological investigation Cytomorphologic study was carried out by using standard azur-eosine staining after Romanovsky-Giemsa, and chromatin pattern after staining with hematoxyline (prepared according to Delafield method) [6], and neutral red. The last staining was adopted in our laboratory. It includes the re-hydratation of the smears followed by their immersion into a 0.5% solution of neutral red (Sigma) in 1% acetic acid and stained for 1.5-2 hours. The process was controlled microscopically. The slides were washed with 1% acetic acid, distilled water, and then dried. Cell dimension analysis was performed by taking cell photo-images in a haemocytometric chamber, and measuring cell diameter (approximately 500 cells were counted). A dimension curve, like Price-Johns curve for red blood cells [7], was built. Cells were distributed into three size groups (below 13 μm, 13-17 μm, and over 17 μm).

2.6 Lactate dehydrogenase and acid phosphatase activity Lactate dehydrogenase and acid phosphatase activities were determined, as described by Lojda [8] and Bessey et al. [9], correspondingly. For evaluation of cell damage, the proportion of enzymatic activity in cell free ascitic fluid and total cell containing ascite after cell lysis by freezing and thawing was determined.

2.7 Statistical analysis A group of 6-8 mice were used in each experiment and repeated three times. Standard deviation was calculated, and a statistical significance of difference was evaluated by using Student’s t-test (P<0.05).

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

3

75

Results

At terminal stages of NK/Ly lymphoma growth, tumor-bearing animals develop typical symptoms of tumor-related cachexia. This is expressed as decreasing carcass, liver and spleen mass (see Figure 1), and a marked worsening of animal status; although the mass of vitally important organs, such as the brain and heart, remain unchanged. Control group Tumor-bearing animals

40

Mass, g

35

5

0

Carcass weight

Liver

Spleen

Brain

Fig. 1 Comparison of pathophysiological indicators in intact and tumor-bearing mice (differences in the cases of carcass, liver, and spleen are statistically significant, P<0.001, 8 mice/group, mean ± SD, all experiments were repeated three times). Carcass weight: control group 36.70 ± 0.47 g, cachectic 31.40 ± 0.88 g; Liver weight: 5.70 ± 0.33 g, cachectic 4.00 ± 0.14 g; Spleen weight: 0.86 ± 0.16 g, cachectic 0.30 ± 0.05 g; Brain weight: 1.60 ± 0.08 g, cachectic 1.60 ± 0.07 g. In Figure 2a, gel electrophoresis results of DNA-PCR products of VEGF, IL-6, and IL1α cytokines are presented, and in Figure 2c, comparative analysis results of the amount of DNA PCR products for all 5 cytokines studied are shown. One can see a high level of expression of VEGF cDNA, comparable to β-actin cDNA in the NK/Ly cells. No changes could be seen in VEGF mRNA expression during tumor growth (Figure 2c). In contrast to VEGF mRNA, the level of expression of IL-6 mRNA in the NK/Ly lymphoma cells was rather low at the initial stages, however, it markedly increased (up to 5-fold) at the terminal stages of tumor growth (Figure 2a, b). An expression of IL-1α mRNA was found to be at a low level (about 5 times lower than IL-6) and it did not change during tumor development. TNF-α and TNF-β mRNAs were expressed at very low levels corresponding to 3 % and 12% of the IL-6 mRNA level, respectively (Figure 2c). The obtained data suggest that these cytokines play a non-significant role in the lymphoma development.

76

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

VEGF

IL-6

IL-1Į

ȕ-actin

a) 100

80

400

300

IL-6

Ratio, %

Quantity of mRNA, relative units

500

60

40 200

20

100

0

0 1

2

3

b)

TNF-a

TNF-b

IL-1a

VEGF

IL-6

c)

Fig. 2 Level of cytokines mRNA production in lymphoma cells measured by RT-PCR. a) Electrophoretic analysis of RT-PCR products of cytokine mRNA expression in NK/Ly tumor cells on different stages of lymphoma progression (n (animals) = 8, the results of typical experiment are presented). 1,2,3 - cells from different mice taken at 1st drainage (7-8 days after inoculation); 4,5 - cells from different mice taken at 2nd drainage (15-16 days after inoculation); 6,7 - cells from different mice taken at 3rd drainage (23-24 days after inoculation) b) Densitometric analysis of IL-6 mRNA expression in NK/Ly tumor cells at different stages of lymphoma progression. 1 – cells taken from 1st drainage (7-8 days after inoculation); 2 – cells taken from 2nd drainage (15-16 days after inoculation); 3 – cells taken from 3rd drainage (23-24 days after inoculation), 1st drainage – 140 relative units, 2nd drainage – 360 relative units, 3rd drainage – 526 relative units; c) Comparative analysis of all studied cytokines expression in NK/Ly tumor cells at 2nd stage of ascite (about 15 days after inoculation). Cytokine mRNA expression compared to β-actin taken as control: TNF-α 3% (in comparison to beta-actin level), TNF-β 12%, IL-1α 20%, VEGF 85%, IL-6 110%. Due to the data on IL-6 mRNA expression, we measured IL-6 concentration in ascitic fluid by ELISA. The results of that study are presented in Figure 3. It was found that

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

77

IL-6 concentration at the initial stage of ascite development (1st drainage, 7-8 days after inoculation) was 90 pg/ml (1 ml of ascite contained 145.0 ± 36.9 × 106 tumor cells), and markedly increased (up to 570 pg/ml, 1 ml of ascite contained 101.5 ± 48.5 × 106 tumor cells) at advanced stages of ascite growth (3rd drainage, 23-24 days after inoculation). In contrast to IL-6, concentration of IFN-γ in ascite was relatively high (1,000 pg/ml) at the beginning of tumor development (1st drainage, 7-8 days after inoculation), and considerably lowered (up to 30 pg/ml) at terminal stages of tumor growth (3rd drainage, 23-24 days after inoculation). The number of tumor cells per 1 ml of the ascite at the 2nd drainage (15-16 days after inoculation) was close to the number found at the 1st drainage.

1000 900 800 IL-6, pg/ml

700 600 500 400 300 200 100 0 1

2

3

2

3

a) 1800 1600

IFN-g, pg/ml

1400 1200 1000 800 600 400 200 0 1

b) Fig. 3 IL-6 and IFN-γ concentration in ascitic fluid measured by ELISA at different stages of tumor development (8 mice/group, mean ± SD, all experiments were repeated twice, p<0.05). a) IL-6: 1st drainage 86.000 ± 34.883 pg/ml, 2nd drainage 169.159 ± 85.999 pg/ml, 3rd drainage 565.181 ± 359.014 pg/ml. b) IFN-γ: 1st drainage 1254.962 ± 396.769 pg/ml, 2nd drainage 71.006 ± 29.008 pg/ml, 3rd drainage 34.533 ± 12.535 pg/ml

78

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

Tumor growth and ageing was accompanied by a degradation of tumor cells. Changes in morphology of NK/Ly lymphoma cells distinctly indicate a progressive cell damage and degradation in the course of tumor growth. We found an evident increase in tumor cell dimensions at late and terminal stages of tumor development (Figure 4). In Figures 5a-c, morphology of NK/Ly cells at the initial and terminal stages of tumor growth is compared. The formation of multiple microvesicles in cell cytoplasm, and their fusion into one giant vacuole was a characteristic feature of tumor cells at late stages, since it was never observed at the initial stages of lymphoma NK/Ly development. An appearance of large cells in a population was accompanied by a considerable vacuolization of their cytoplasm. However, many large cells were found to be bi-nucleated and died after a short period of time. The revealed changes in cellular chromatin pattern at late stages of tumor growth are characterized by a condensation resembling the beginnings of chromosome formation without its completion and proper orientation. Also, chromatin hyper-condensation and formation of small dense particles in the nucleus, as well as swelling and loosening of nucleus due to a loss of material, were observed in dead cells. The lymphoma cells at the 1st and 2nd drainages (7-8 and 15-16 days after inoculation, respectively) showed 99% viability, while at the terminal stages of tumor growth ( 23-24 days after inoculation) the lymphoma cell viability ranged from 37% to 77%, depending on the individual tumor-bearing animal. A release of LDH and AP from the lymphoma NK/Ly cells was expressed as a proportion of those enzymatic activities in cell–free ascitic fluid to total enzymatic activity in the original cell suspension after cell permeabilization (Figure 6). Presented data show a progressive increase in the activity of both enzymes in extracellular medium, which becomes statistically significant only at late or terminal stages of tumor development, due to large deviations from the mean values. The LDH activity was increased earlier and to a greater extent than that of the AP. We suppose that AP appearance in the ascitic fluid corresponds to more severe cell damage. The obtained data on cytomorphological and biochemical analyses of tumor cells were confirmed by a DNA electrophoresis study in agarose gel, which showed that degenerative processes in NK/Ly lymphoma cells at advanced stages of tumor growth were accompanied by an intensive apoptotic fragmentation of DNA in these target cells (Figure 7). A strong negative correlation (r= −0.95) was revealed between the number of viable cells and IL-6 concentration, while a positive correlation (r= 0.86) existed between the number of alive cells and IFN-g concentration. As for other indicators, such as number of macrocytes and ascite volume, their correlation with IL-6 concentration was less tight, but also reliable (r= 0.78 and r= 0.71, correspondingly).

79

32

34

36

38

40

32

34

36

38

40

30

28

26

24

22

20

18

16

14

12

22 20 18 16 14 12 10 8 6 4 2 0 10

% of cells

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

Cell diameter, um

a)

% of cells

22 20 18 16 14 12 10 8 6

30

28

26

24

22

20

18

16

14

12

10

4 2 0

Cell diameter, um

b) 18 16 14

% of cells

12 10 8 6 4 2 0 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Cell diameter, um

c) Fig. 4 Frequency distribution of ascitic cells of NK/Ly tumor, based on tumor cell size, at different stages of tumor growth. a)7-8 days, b) 15-16 days, c) terminal stage (23-24 days) of lymphoma growth.

80

4

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

Discussion

Cytokines and lymphokines were assumed to play an important role in the development of endogenous intoxication and manifestation of cachexia in cancer patients [10–12]. There is no data on production of specific cytokines/lymphokines in murine lymphoma NK/Ly, proposed as an experimental model for evaluating the antitumor activity of different agents [1]. We selected five cytokines (IL-1a, IL-6, TNF-α, TNF-β, VEGF) which were suggested to be involved in the development of intoxication, caused by growth of this tumor. B

A

C

Fig. 5 Morphology of lymphoma NK/Ly cells (ascitic form) during carcinogenesis (after Romanovsky-Giemsa, neutral red and hematoxylin staining). a) 1st drainage (7-8 days), Romanovsky-Giemsa staining; b) 2nd drainage (15-16 days), neutral red staining; c) 3rd drainage (23-24 days), hematoxylin staining. IL-6, a 26 kDa protein, is a pleiotropic cytokine which was originally identified as a B-cell differentiation factor. It induces maturation of B cells into the antibody-producing ce1ls and also exhibits different effects towards some other types of cells [13]. An elevated serum level of IL-6 was demonstrated in an experimental cachexia model in Balb/c x DBA/2(CD) mice bearing colon carcinoma [14, 15], and other types of cancer [16, 17]. IL-6 elevation was also demonstrated immunohistochemically in human tumor specimens [18]. Moreover, some pro-cachectic effects of that cytokine were neutralized by

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

81

60

60

50

50

% of relative activity

% of relative activity

anti-IL-6 antibodies [15, 19, 20]. Cancer cells of different origin and location produce IL-6 and express its specific receptors [11, 21]. This ability is typical for cells of different melanoma lines, renal, intestine, neck squamous carcinoma, and breast adenocarcinoma [22–24]. IL-6, VEGF, and TNF-α expression was enhanced at multiple myeloma, and these cytokines could serve as biomarkers of multiple myeloma progression [25–29].

40 30 20 10 0

40 30 20 10 0

1

2 Drainage num ber

a)

3

1

2

3

Drainage num ber

b)

Fig. 6 Ratio of activity of acid phosphatase a) and lactate dehydrogenase b) in cell-free ascitic fluid to total ascites lysates of NK/Ly murine lymphoma (mean±SD, difference in relation to drainage I was p<0.05). Acid phosphatase: 1st drainage 2.3±1.1% of relative activity, 2nd drainage 5.3±2.7%, 3rd drainage 20.1±7.0%. Lactate dehydrogenase: 1st drainage 4.6±1.4% of relative activity, 2nd drainage 18.4±6.0%, 3rd drainage 35.9±13.7%

Fig. 7 Electrophoretic study of DNA fragmentation in NK/Ly lymphoma cells at different stages of tumor development 1 – 1st drainage, 2 – 2nd drainage, 3 – 3rd drainage. Among five cytokines measured in the NK/Ly lymphoma cells at different stages of tumor growth, there was only one cytokine, IL-6, whose mRNA expression was increased.

82

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

The level of its mRNA was low at the first drainage after inoculation, and then it rapidly increased at the 2nd and especially 3rd drainages, which correlated with cachexia progression in the tumor-bearing animals. An ELISA study of IL-6 content showed even stronger (up to 7-fold) increase in IL-6 concentration in ascite at late stages of tumor growth. Since IL-6 is a potent pro–inflammatory cytokine and exhibits multiple effects, an observed rapid increase in the level of expression of its mRNA suggests an important role of IL-6 in cachexia development at terminal stages of tumor growth. VEGF is a major cytokine involved in tumor progression and is highly expressed during carcinogenesis. We found that mRNA for VEGF was highly expressed and its level was constant throughout all stages of tumor growth. VEGF is responsible for a continuous ascite formation, leading to dehydratation of peripheral tissues, and worsening of the general state in tumor-bearing animals [30, 31]. Since mRNAs coding for the other cytokines studied (IL-1α, TNF-α, TNF-β) were expressed in trace levels, we suggest that these cytokines might not be involved in the development of complications, e.g. cachexia accompanying tumor growth. IFN-γ could also be involved in cancer cachexia [32]. IFN-γ administration can increase survival outcomes in a variety of cancers [33] by stimulating cellular immunity [34]. Low IFN-γ serum level, elevated IL-6 levels, extensive disease, malnutrition, and acute phase response were all related to a shorter survival time [35]. A decrease in IFN-γ concentration correlated with worsening physiological status in tumor-bearing animals. IFN-γ could affect cachexia development by suppressing IL-6 production in the malignant cells, as shown in [36]. Thus, a rapid decrease in IFN-γ at late stages of NK/Ly lymphoma growth might worsen a condition in tumor-bearing animals by abolishing a block in IL-6 production by tumor cells. LDH and AP activities measured extracellulary are often used as biomarkers of cell damage. At early stages of cell damage, oscillations in the LDH level in the extracellular medium are reversible; while at advanced stages of cell destruction a sharp increase in enzymatic activity in the extracellular medium specifies cell death. AP is a lysosomal enzyme that is separated from the extracellular medium by both plasma membrane and lysosomal membrane. Thus, AP can be detected in the extracellular medium only after a severe cell damage, when the plasma and lysosomal membranes are altered, causing a leakage of lysosomal content. It may be concluded that an increase in LDH level in extracellular medium can serve as marker of early destructive processes in target cells, while an increase in the AP level indicates massive cell degradation at advanced stages of cell damage. Morphological changes in the NK/Ly lymphoma cells at different stages of tumor growth confirmed our suggestions about the cell damage. The cells obtained from the first drainage (7-9 days after tumor inoculation) of the ascites were shown to be mostly intact. They had no structural changes in the nucleus, though some membrane “bubbling” was observed. The cells from the 2nd drainage (15-16 days after tumor inoculation) possessed a condensed or distended nucleus, while the cells from the 3rd drainage (23-24 days after inoculation) had a marked cytoplasm vacuolization and nucleus fragmentation, indicating

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

83

a development of degenerative processes. The microscopic study of these tumor cells showed that some of them were also necrotic, and that could lead to an inflammatory response in the organism. DNA electrophoresis study of NK/Ly lymphoma cells has shown an intensive DNA laddering in samples from the 3rd drainage (23-24 days after inoculation), thus demonstrating an increased number of apoptotic cells at late stages of tumor growth. During a process of NK/Ly ascitic tumor growth and ageing, the number of lymphoma cells with enlarged dimensions (macrocytes) increased significantly. Their appearance could be caused by DNA lesions in aged tumor cells causing an arrest in cell pass through cell cycle checkpoints. Being arrested in these checkpoints, lymphoma cells continue increasing their mass and size without a mitotic division. The degradation and destruction of tumor cells at late stages of ascites caused a massive release of cell content into the ascitic fluid, which was confirmed by LDH and AP release into the culture medium. It may be suggested that some cytokines, especially IL-6, are increased in the extracellular medium due to damage of lymphoma cells, especially at terminal stages of tumor growth, thus resulting in the worsening of general organismal status and switching on the cachexia in the tumor-bearing animals. This suggestion can be supported by a strong negative correlation (r= −0.95) between the number of viable lymphoma cells and IL-6 concentration in ascitic fluid. Such correlation, as well as high levels of IL-6 mRNA in tumor cells, suggests that damaged NK/Ly lymphoma cells could be the main source of IL-6 in the extracellular medium. Accumulation of this cytokine in the ascitic fluid at late stages of tumor growth can cause a manifestation of cachexia in the tumor-bearing mice.

Acknowledgment The authors thank Vitalyi Kaminskyy, PhD for his help in performing some experiments. The work was partially supported by the West-Ukrainian BioMedical Research Center which awarded N. Boiko by a grant for 2005-2006.

References [1] L. Nemeth and B. Kellner: “A new mouse ascites tumor to be used as screening tool”, Neoplasma, Vol. 8, (1961), pp. 337–343. [2] L. Kopper, A. Jeney, J. Tak´acs, I. Benedeczky, E. Dzurillay and K. Lapis: “Studies of the Growth of an Ascitic Tumour. I. Cellular and Subcellular Changes During the Tumour Growth”, Eur. J. Cancer, Vol. 14, (1978), pp. 59–73. [3] L. Kopper, A. Jeney, K. Lapis and M. T¨or¨ok: “Studies of the Growth of an Ascitic Tumour. II. A System to Study the Tumour-Age Dependent Effect of Antitumour Agents”, Eur. J. Cancer, Vol. 14, (1978), pp. 75–82. [4] A. Kurnatowski and R.G. Willighagen: “Cytochemistry of the NK/Ly Lymphoma”, Nature, Vol. 198, (1961), pp. 1211–1212.

84

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

[5] M.A. Halma, N.M. Wheelhouse, M.D. Barber, J.J. Powell, K.C. Fearon and J.A. Ross: “Interferon-gamma polymorphisms correlate with duration of survival in pancreatic cancer”, Hum. Immunol., Vol. 65, (2004), pp. 1405–1408. [6] S. Zawistowski: Technika Histologiczna: Histologia oraz podstawy histopatologii, Panstowy Zaklad Wydawnictwa Lekarskich, Warszawa, 1983 (in Polish). [7] C. Price-Jones: Red Blood Cell Diameters, Oxford Univ. Press, London, 1934. [8] Z. Lojda: “Remarks on biochemical detection of dehydrogenases”, Folia Morphol. (Praha), Vol. 13, (1965), pp. 84–96. [9] O.R. Bessey, O.H. Lowry and M.J. Brock: “A method for the rapid determination of acid phosphatase with five cubic millimeters of serum”, J. Biol. Chem., Vol. 164, (1946), pp. 321–329. [10] N.M. Berezhnaya and V.F. Chekhun: Interleukin System and Cancer, DIA, Kyiv, 2000 (in Russian). [11] N.M Berezhnaya and V.F. Chekhun: Immunology of Malignant Growth, Naukova Dumka, Kyiv, 2005 (in Russian) [12] M.J. Tisdale: “Pathogenesis of Cancer Cachexia”, J. Support Oncol., Vol. 1, (2003), pp. 159–168. [13] S. Rose-John, J. Scheller, G. Elson and S.A. Jones: “Interleukin-6 biology is coordinated by membrane-bound and soluble receptors: role in inflammation and cancer”, J. Leukoc. Biol., Vol. 80, (2006), pp. 227–236. [14] K. Fujimoto-Ouchi, E. Onuma, M. Shirane, K. Mori and Y. Tanaka: “Capecitabine improves cancer cachexia and normalizes IL-6 and PTHrP levels in mouse cancer cachexia models”, Cancer Chemother. Pharmacol., (2006), Sep 29 (Epub ahead of print). [15] G. Strassmann, M. Fong, J. Kenney and C.O. Jacob: “Evidence for the involvement of interleukin 6 in experimental cancer cachexia”, J. Clin. Invest., Vol. 89, (1992), pp. 1681–1684. [16] J.M. Argiles, S. Busquets and F.J. Lopez-Soriano: “Cytokines in the pathogenesis of cancer cachexia”, Curr. Opin. Clin. Nutr. Metab. Care, Vol. 6, (2003), pp. 401–406. [17] M.E. Martignoni, P. Kunze, W. Hildebrandt, B. Kunzli, P. Berberat, T. Giese, O. Kloters, J. Hammer, M.W. Buchler, N.A. Giese and H. Friess: “Role of mononuclear cells and inflammatory cytokines in pancreatic cancer-related cachexia”, Clin. Cancer. Res., Vol. 11, (2005), pp. 5802–5808. [18] S. Tabibzadeh, A. Poubouridis, L. May and P.B. Sehgal: “Interleukin-6 immunoreactivity in human tumors”, Am. J. Pathol., Vol. 135, (1989), pp. 427–433. [19] A. Enomoto, M.C. Rho, A. Fukami, O. Hiraku O, K. Komiyama and M. Hayashi: “Suppression of cancer cachexia by 20S,21-epoxy-resibufogenin-3-acetate-a novel nonpeptide IL-6 receptor antagonist”, Biochem. Biophys. Res. Commun., Vol. 323, (2004), pp. 1096–1102. [20] M. Trikha, R. Corringham, B. Klein and J.-F. Rossi: “Targeted Anti-Interleukin-6 Monoclonal Antibody Therapy for Cancer: A Review of the Rationale and Clinical Evidence”, Clin. Cancer Res., Vol. 9, (2003), pp. 4653–4665.

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

85

[21] G. Lelli, M. Montanari, G. Gilli, D. Scapoli, C. Antonietti and D. Scapoli: “Treatment of the cancer anorexia-cachexia syndrome: a critical reappraisal”, J. Chemother., Vol. 15, (2003), pp. 220–225. [22] Z. Chen, P.S. Malhotra, G.R. Thomas, F.G. Ondrey, D.C. Duffey, C.W. Smith, I. Enamorado, N. T. Yeh, G.S. Kroog, S. Rudy, L. McCullagh, S. Mousa, M. Quezado, L.L. Herscher and C. Van Waes: “Expression of Proinflammatory and Proangiogenic Cytokines in Patients with Head and Neck Cancer”, Clin. Cancer Res., Vol. 5, (1999), pp. 1369–1379. [23] B. Knoefel, K. Nuske, T. Steiner, K. Junker, H. Kosmehi, K. Rebstock, D. Reinhold and U. Junker: “Renal cell carcinoma produce IL-6, IL-10, IL-11 and TGF-beta1 in primary cultures and modulate T lymphocyte blast transformation”, J. Interferon Cytokine Res., Vol. 17, (1997), pp. 95–102. [24] K.V. Woods, A. El-Naggar, G.L. Clayman and E.A. Grimm: “Variable expression of cytokines in human head and neck squamous carcinoma cell lines and consistent expression in surgical specimens”, Cancer Res., Vol. 58, (1998), pp. 3132–3141 [25] M.G. Alexandrakis, F.H. Passam, E.S.Ganotakis, K. Sfiridaki, I. Xilouri, K. Perisinakis and D.S. Kyriakou: “The clinical and prognostic significance of erythrocyte sedimentation rate ESR, serum interleukin-6 (IL-6) and acute phase protein levels in multiple myeloma”, Clin. Lab. Haematol., Vol. 25, (2000), pp. 41–46. [26] M.G. Alexandrakis, C.A. Pappa, S. Miyakis, A. Sfiridaki, M. Kafousi, A. Alegakis and E.N. Stathopoulos: “Serum interleukin-17 and its relationship to angiogenic factors in multiple myeloma”, Eur. J. Intern. Med., Vol. 17, (2006), pp. 412–416. [27] M. Herrmann, H.M. Lorenz, R. Voll, M. Grunke, W. Woith and J.R. Kolden: “A rapid and simple method for the isolation of apoptotic DNA fragments”, Nucl. Acids Res., Vol. 22, (1994), pp. 5506–5507. [28] R.E. Kast: “Aspirin, TNF-alpha, NFkB, and survival in multiple myeloma: the importance of measuring TNF-alpha”, Inflammopharmacology, Vol. 14, (2006), pp. 256–259. [29] T. Kimlinger, M. Kline, S. Kumar, J. Lust, T. Witzig and S.V. Rajkumar: “Differential expression of vascular endothelial growth factors and their receptors in multiple myeloma”, Haematologica, Vol. 91, (2006), pp. 1033–1040. [30] M.I. Koukourakis, D. Papazoglou, A. Giatromanolaki, G. Bougioukas, E. Maltezos and E. Sivridis: “VEGF gene sequence variation defines VEGF gene expression status and angiogenic activity in non-small cell lung cancer”, Lung Cancer, Vol. 43, (2004), pp. 293–298. [31] D.R. Senger, S.J. Galli, A.M. Dvorak, C.A. Perruzzi, V.S. Harvey and H.F. Dvorak: “Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid”, Science, Vol. 219, (1983), pp. 983–985. [32] Y. Noguchi, T. Yoshikawa, A. Matsumoto, G. Svaninger and J. Gelin: “Are cytokines possible mediators of cancer cachexia?”, Surg Today, Vol. 26, (1996), pp. 467–475.

86

R.R. Panchuk / Central European Journal of Biology 2(1) 2007 71–86

[33] H. Ishikawa, N. Tsuyama, M. Obata and M. Kawano: “Mitogenic signals initiated via interleukin-6 receptor complexes in cooperation with other transmembrane molecules in myelomas”, J. Clin. Exp. Hematop., Vol. 46, (2006), pp. 55–66. [34] A. Nicolini, A. Carpi and G. Rossi: “Cytokines in breast cancer”, Cytokine Growth Factor Rev., Vol. 17, (2006), pp. 325–337. [35] F. Martin, F. Santolaria, N. Batista, A. Milena, E. Gonzalez-Reimers, M.J. Brito and J. Oramas: “Cytokine levels (IL-6 and IFN-γ), acute phase response and nutritional status as prognostic factors in lung cancer”, Cytokine, Vol. 11, (1999), pp. 80–86. [36] G. Monti, M.C. Jauraud, I. Monnet, P. Chrdtien, L. Saint-Etienne, L. Zeng, A. Pottier, P. Deviller, P. Galanaud, J. Bignon and D. Emilie: “Intrapleural production of interleukin 6 during mesothelioma and its modulation by gamma-interferon treatment”, Cancer Res., Vol. 54, (1994), pp. 4419–4423.