J. Plant Biol. (2013) 56:232-242 DOI 10.1007/s12374-013-0085-7
ORIGINAL ARTICLE
Molecular Genetic Characterization of Rice Seed Lipoxygenase 3 and Assessment of Its Effects on Seed Longevity Qizhang Long1, Wenwei Zhang1, Peng Wang1, Wenbiao Shen1, Tong Zhou1, Nannan Liu1, Ren Wang1, Ling Jiang1, Jiexue Huang1, Yihua Wang1, Yuqiang Liu1 and Jianmin Wan1,2,* 1
State Key Laboratory for Crop Genetics & Germplasm Enhancement, Jiangsu Provincial Center of Plant Gene Engineering, Nanjing Agricultural University, Weigang 1, Nanjing 210095, China 2 Institute of Crop Science, The National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing 10081, China Received: March 4, 2013 / Accepted: May 10, 2013 © Korean Society of Plant Biologists 2013
Abstract Lipoxygenases (LOXs) are enzymes involved in lipid peroxidation. Here we reported the identification, molecular and functional characterization of the gene encoding rice (Oryza sativa L.) seed LOX3 (sLOX3). Via a map-based cloning strategy we identified Os03g0700400 as the candidate gene encoding sLOX3. Further functional complementary test and biochemical characterization of the recombinant Os03g0700400 protein verified the identification. The sLOX3 gene was highly expressed in roots, moderately in embryos and very weakly in leaves, leaf sheaths and stems. Transient expression experiment (in rice protoplasts) and subsequent laser confocal microscopic analysis demonstrated that the sLOX3 protein was localized into the cytosol. We next showed that overexpression of sLOX3 in a japonica sLOX3-normal rice cultivar, Wuyunjing 7 accelerated the decrease of seed germination ability when the seeds were routinely stored, which demonstrated that sLOX3 had a negative effect on seed longevity (storability). Meanwhile, an increased occurrence of embryo decay was observed in the same transgenic seeds, suggesting that sLOX3 might negatively affect seed longevity by facilitating colonization of particular seed pathogens. Our result forwarded the understanding of the effects of 9-LOX on rice seed longevity. Key words: Cloning, Lipoxygenase, Prokaryotic expression, Seed longevity, Subcellular localization
*Corresponding author; Jianmin Wan Tel : +86-25-84396516 E-mail :
[email protected]
Introduction Lipid peroxidation is common to all biological systems. The initial step of lipid peroxidation is the formation of hydroperoxides, which may occur by autooxidation or by the action of enzymes such as lipoxygenases (LOXs) (Feussner and Wasternack 2002). In plants, lipoxygenases mainly act on polyunsaturated fatty acids (PUFAs) including linolenic acid and linoleic acid, and may only oxygenate the substrates either at carbon 9 or at carbon 13 of the hydrocarbon backbone to form two groups of hydroperoxides: 9(S)hydroperoxy- and 13(S)-hydroperoxy-derivatives of PUFAs. Lipoxygenases are accordingly grouped into 9-LOXs and 13LOXs (Feussner and Wasternack 2002). Some lipoxygenases may possess predominantly either 9-LOX or 13-LOX activity, and some others may have both equally. There are many kinds of downstream enzymes that can metabolize the fatty acid hydroperoxides to generate a range of compounds collectively named oxylipins (Grechkin 1998; Feussner and Wasternack 2002; Mosblech et al. 2009). These structurally diverse metabolites have important roles in plant development and defense (Porta and Rocha-Sosa 2002). LOXs are present in seeds of many plant species. Seed LOXs may be involved in fatty acid peroxidation in membranes or storage lipids, production of growth regulators, responses to pathogens, and nitrogen storage (Loiseau et al. 2001). In soybean seeds, LOXs are abundant proteins that constitute 12% of the total protein content (Loiseau et al. 2001). The enzymes are involved in the production of volatile compounds (such as n-hexanal) associated with grassybeany and rancid off-flavors in soybean and soy foods (Robinson et al. 1995). Foods made from soybean lacking LOXs generate less hexanal than do those with normal LOX
J. Plant Biol. (2013) 56:232-242
activities (King et al. 2001). As LOX activities are also present in rice seeds (Shastry and Rao 1975) and hexanal is the predominant component of stale off-flavors derived from lipid peroxidation in stored rice seeds (Chikubu 1970), rice seed LOXs were also believed to play some roles in lipid peroxidation in rice seeds (Sekhar and Reddy 1982). Compared to soybean, rice seed LOX activity is low and present mainly in embryo and bran fractions (Yamamoto et al. 1980).The rice seed has three forms of LOXs (namely LOX1, LOX2 and LOX3), among which LOX3 are predominant (Ida et al. 1983). The LOX3 component was further highly purified and characterized as a 9-LOX (Ohta et al. 1986). In rice bran, as seed LOXs are closely associated with the high susceptibility of the lipids to oxidative rancidity, the inactivation of the enzymes (including lipases and LOXs) involved in the lipid oxidation processes is important for the stabilization of rice bran (Ramezanzadeh et al. 1999; Malekian et al. 2000). Suzuki et al. (1999) found that the brown rice of varieties lacking the seed LOX3 (sLOX3 for short) generates much fewer volatiles derived from lipid peroxidation including hexanal, pentanal, and pentanol than do that of varieties with sLOX3 during storage at 35oC, suggesting that LOXs may also have a big effect on the lipid pexodiation in the intact and dry stored rice seeds as do they in the bran tissues with cellular de-compartmentation and high hygroscopicity. As the absence of the sLOX3 enzyme has the potential for alleviating seed lipid peroxidation, varieties lacking sLOX3 proteins such as “Daw Dam” (a Thailand javanica rice variety) were identified using sLOX3 monoclonal antibody (Suzuki et al. 1993; Suzuki et al. 2000). The absence of sLOX3 in the seeds of variety “Daw Dam” was indicated to be controlled by one recessive qualitative genetic locus (Suzuki et al. 1996). In the present study, we identified the gene encoding rice sLOX3 and further investigated the gene expression pattern, the protein subcellular localization and the effects of the enzymatic activities on seed longevity.
Results Identification of the Gene Encoding sLOX3 A map-based cloning strategy was employed to identify the gene encoding sLOX3. To quickly identify phenotypes (sLOX3 presence or absence) of plants in a large genetic population used for gene mapping, a method based on a simple color test on mature embryos was developed (see Methods). Using a F2 population of “Daw Dam (a sLOX3-null javanica rice variety) × IRBB7 (a sLOX3-normal indica rice variety)”, the slox3 locus was located to the region between the markers RM3405 and SSR3-183 on Chromosome 3 (Fig. 1A; see
233
Fig. 1. Fine mapping of the sLOX3/slox3 locus. (A) The fine mapping result for the sLOX3/slox3 locus. RM3405 and SSR3183, two SSR markers; ORF1 and ORF3, hypothetical proteins; ORF2 and ORF4, putative lipoxygenases; ORF5, putative natural resistance-associated macrophage protein. The figures beneath the signs of the two markers show the number of recombinants among 641 recessive homozygotes. The ORF2 (Os03g0700400) was considered as the sLOX3 candidate. (B) Illustration of Os03g0700400 (sLOX3 candidate) gene structure and the sequence differences between “Nipponbare” and sLOX3-null varieties. Black boxes on the DNA map, exons; lines on the DNA map, introns; small triangle beneath the first intron, an “AA” insertion; line beneath the seventh exon, a point mutation leading to stop codon.
Supporting Information 1 for detail). According to the annotation data given by the Rice Annotation Project (Ohyanagi et al. 2006), there are five ORFs (Open Reading Frames) in the interval, among which ORF2 and ORF4 were predicted to encode LOX proteins (Fig. 1A). ORF4 had been characterized as a 9/13-LOX gene (Wang et al. 2008), so ORF2 (Os03g0700400) was considered as the sLOX3 candidate. As annotated, Os03g0700400 has nine exons and contains 4402 nucleotides in the coding region. The protein encoded by Os03g0700400 was deduced to consist of 866 amino acid residues. A “G” (Nipponbare) to “A” (sLOX3-null varieties) transition mutation occurring at the 3128th nucleotide of the Os03g0700400 (within the 7th exon) was found. The mutation was deduced to cause a premature stop codon, which should account for the sLOX3 absence. Meanwhile, another mutation site was found: a poly(A)10 sequence at the 420430th nucleotides (within the first intron) of the normal Os03g0700400 sequence was extended to a poly(A)13 one (Fig. 1B). In addition, a cDNA of Os03g0700400 was overexpressed in the sLOX3-null cultivar PL2 and the transgenic seeds were expected to gain the specific color formation ability of sLOX3-normal ones. Indeed, the result obtained coincided with our expectation (Fig. 2), which further suggested that Os03g0700400 encoded sLOX3.
234
Fig. 2. Test for the color formation ability of seeds from T1 plants of a transgenic PL2 line overexpressing Os03g0700400. In the test, a dark purple color can be formed by sLOX3-normal rice seeds but only a light one can be done by sLOX3-null ones. The figure showed that the OE-sLOX3 seeds of PL2 (a sLOX3-null cultivar) gained the color formation ability owned by those of sLOX3-normal cultivars such as WYJ 7. AA, a homozygous transgenic T1 progeny of PL2 (All its seeds can form a dark purple color as those of WYJ 7); aa, a non-transgenic homozygous progeny (All its seeds can only form a light purple color as those of PL2); Aa, a heterozygous transgenic progeny (Its seeds showed segregation of the two phenotypes). The transgene in the line was indicated to be inserted with one copy or at one site (based on an analysis towards the color formation ability of seeds from 35 T1 plants; data not shown). The presence of the transgene in the regenerated plant was indicated by PCR detection (See Fig. S7C).
sLOX3-null Varieties Share the Same Mutation in Os03g0700400 Sequence To enrich the genetic resources for breeding application, nine varieties showing sLOX3 absence were identified from 199 indigenous varieties of China by screening through the color test mentioned earlier. Interestingly, all the nine varieties are from Yunnan province of the country. Allelism analysis indicated that the same gene locus as that in “DawDam” controls sLOX3 absence in all the sLOX3-null varieties identified by us (data not shown). Sequencing analysis of the Os03g0700400 sequences indicated that all the sLOX3-null varieties shared the same mutation causing a premature stop codon, which suggested that the mutated Os03g0700400 sequences in the sLOX3-null varieties had a common origin. The result also suggested that Os03g0700400 encodes sLOX3. Biochemical Characterization of Recombinant Os03g0700400 Proteins A cDNA of Os03g0700400 fused with a preceding His-tag sequence was expressed in E. coli strain BL21 (DE3). Most
J. Plant Biol. (2013) 56:232-242
Fig. 3. Optimal pH and temperature ranges for the enzymatic activity of recombinant Os03g0700400. LOX activity was denoted as the rate of hydroperoxides formed within the initial one minute. Reactions were carried out in the buffers containing 0.33 mM sodium linoleate, 0.013% Tween-20, 25oC in a total volume of three milliliters. Buffers used for optimal pH investigation: 0.2 M NaAC-HAC (pH 3.0-6.0), 0.1 M NaH2PO4-Na2HPO4 (pH 6.0-8.0) and 0.1 M Tris-HCl (pH 8.0-9.0). For optimal temperature determination, 0.1 M Tris-HCl buffer (pH 7.0) was used and only the activity towards linoleic acid was determined. The supernatant of E. coli cell lysates was used as crude enzyme solution and the control E. coli expressing the tag polypeptide of pET-30a served as control. Values are means ± SDs of three replicates.
of the recombinant proteins were shown to exist as inclusion bodies though being induced under a low temperature condition (16oC). Nevertheless, high LOX activities could still be detected in the supernatant of the cell lysate (Fig. S5 in Supporting Information 2). Thus, Os03g0700400 encodes an authentic LOX protein. Enzymatic properties of the recombinant proteins were characterized. The fusion proteins were demonstrated to act on linolenic acid and linoleic acid with nearly equal efficiency (Fig. 3A). A wide optimal pH range (5.0-7.0) for the enzyme was also shown. Meanwhile, the optimal temperature for the activity was indicated to be around 50oC (Fig. 3B). To know the regio-specificity of Os03g0700400, we analyzed the reaction products obtained using either linoleic acid or linolenic acid as substrates through normal phasehigh performance liquid chromatography (NP-HPLC). The enzyme was indicated to generate predominantly 9hydropexides (9-HPOD/T) (Fig. 4 and Fig. S6 in Supporting Information 2). Thus, Os03g0700400 is a 9-LOX. To know the stereo-specificity of Os03g0700400, we further analyzed the 9-HPOD and 9-HPOT purified from NP-HPLC by CP-HPLC (chiral-phase HPLC). Both the 9HPOD and 9-HPOT were indicated to mainly consist of Senantiomer (Fig. 4C and Fig. S6 in Supporting Information 2). Thus, Os03g0700400 is a 9(S)-LOX. The high similarity of Os03g0700400 with the previously purified sLOX3 protein (Ida et al. 1983) in the properties of the LOX activity confirmed that Os03g0700400 encodes the sLOX3 protein. So far, multiple evidences supported that Os03g0700400 encodes the sLOX3 protein. Hereafter, Os03g0700400 was referred to as sLOX3.
J. Plant Biol. (2013) 56:232-242
Fig. 4. HPLC analysis of hydroperoxides formed from linoleic acid by recombinant Os03g0700400. The regio-specificity of Os03g0700400 was analyzed by normal-phase HPLC. The stereospecificity was analyzed by chiral-phase HPLC. (A) 13(S)-HPOD standard, (B) 9(S)-HPOD standard, (C) hydroperoxides of linoleic acid produced by partially purified recombinant Os03g0700400. (D) hydroperoxides of linoleic acid produced by partially purified proteins (mainly the tag polypeptides) from control E.coli carrying pET-30a empty vector. The inset box in Chart C indicates elution profile of 9-HPOD purified from NP-HPLC in CP-HPLC analysis.
235
Fig. 6. Subcellular localization of Os03g0700400 in rice protoplasts. The whole protein of Os03g0700400 was fused with the GFP tag at the C terminus, and the fusion protein was transiently expressed in rice protoplasts prepared from sheaths of 10 days old seedlings. The cells transformed with empty vector pAN580 to express mere GFP served as control. Cells were visualized under a laser scanning confocal microscope. (A, D) Fluorescence of GFP; (B, E) autofluorescence of chlorophyll; (C, F) overlapping of GFP and chlorophyll signals.
moderately expressed in the panicle and very weakly in the leave, the sheath and the stem. Moreover, it was indicated that in the embryo the gene expression was affected by developmental stages. sLOX3 Is Localized Into the Cytosol
Fig. 5. Temporal and spatial expression of Os03g0700400. The expressions were examined in rice tissues including leaves, sheaths, stems and panicles. The expressions in embryos at different developmental stages (6, 9, 12, 15, 18, 21 days after flowering) were investigated. The mRNA levels were measured by qRT-PCR. Values are means ± SD of three replicates.
Temporal and Spatial Expression of sLOX3 Expressions of sLOX3 were examined in various rice tissues. Consistent with the initial isolation of the sLOX3 protein from the embryo (Ida et al. 1983), sLOX3 was truly expressed in the organ. However, its highest expression was found in the root (Fig. 5). The gene was also found to be
sLOX3 was predicted to be localized into cytosol by online tools “WoLF PSORT” (Horton et al. 2007) and “SubLoc” (Hua and Sun 2001). To validate the prediction, sLOX3 fused with green fluorescent protein (GFP) at the C terminus (sLOX3-GFP) was transiently expressed in rice protoplasts and the subcellular location was subsequently examined by laser scanning confocal microscope. As was the case in cells expressing mere GFP (GFP has no organellar localization signals) (Fig. 6D, E, F), the cells expressing sLOX3-GFP (Fig. 6A, B, C) exhibited continuously spreading GFP fluorescence surrounding the chloroplasts across the cell section in confocal microscopic analysis. The result indicated that the sLOX3-GFP protein was present in the cytosol, which suggested that sLOX3 is a cytosolic protein. Overexpression of sLOX3 Decreases Rice Seed Longevity Previous workers have shown that sLOX3 promotes lipid oxidation of rice seeds (Suzuki et al. 1999). As lipid deterioration is among the factors decreasing seed longevity, it is deducible that sLOX3 may negatively affect seed longevity. To test this, we generated transgenic plants overexpressing sLOX3 in a japonica cultivar Wuyunjing 7 (a sLOX3-normal cultivar; WYJ7 for short hereafter) and
236
J. Plant Biol. (2013) 56:232-242
Fig. 7. Effect of sLOX3 overexpression on longevity of seeds subjected to natural aging. Seeds from T1 OE-sLOX3 plants of WYJ7 were used in the experiment. Transgenic and control seeds packed in paper bags were stored in a semi-underground storeroom with ambient temperature and humidity. Germination frequency was used for indicating seed viability and aging index ([germination percentage before treatment - germination percentage after treatment] /germination percentage before treatment) for aging rate. LOX activity was shown to be largely enhanced in seeds of OE-sLOX3 plants (A); a decrease of seed viability was observed for both the fresh and stored OE-sLOX3 seeds as compared to the wild type (B); the OE-sLOX3 seeds showed a faster loss of viability during storage than the wild type did (C); an enhanced embryo decay was found in the OE-sLOX3 seeds stored for 26 months (D). WYJ7, a sLOX3-normal cultivar (wild type); B#, names of independent OE-sLOX3 lines; OE-sLOX3 (+), mixed seeds of homozygous transgenic T1 segregating progenies; OE-sLOX3 (−), mixed seeds of homozygous non-transgenic T1 segregating progenies or wild type. na, not applicable (or lacking seeds). Values are means ± SD (n=3 for data in Chart A and B; n=4 for those in Chart D). Significance was determined by Student’s t test (*, P<0.05; **, P<0.01).
further compared the longevity of the OE-sLOX3 seeds with that of the wild type ones. The presence of the transgene in the genome of the regenerated plant was validated by PCR analysis (Fig. S7 in Supporting Information 2). Seed LOX activities in most of the independent OE-sLOX3 lines were shown to be largely enhanced relative to that in the wild type and eight such transgenic lines were used in the subsequent comparative analysis (Fig. 7A). The seed longevity was assessed with the seed aging rate during storage and the aging rate was indicated by the aging index of the seeds after a time of storage (aging index = [germination percentage before storage - germination percentage after storage]/germination percentage before storage). It was observed that even before storage, the seeds of some OE-sLOX3 lines showed slightly lower germination percentage than the wild type did (Fig. 7B). When being stored for about two years (stored at a semi-underground storeroom with ambient temperature and humidity), the differences between the OE-sLOX3 seeds and the wild type ones in germination percentage increased (Fig. 7B). It means that the OE-sLOX3 seeds showed a greater
aging index as compared to the wild type (Fig. 7C). After being stored for 26 months, transgenic seeds had an averaged aging index 2.4 times as high as that of wild type control. To exclude the possibility that the differences resulted from random mutations introduced during the tissue culture process, it was also determined that the seed germination percentage of the non-transgenic segregating progenies of each independent lines (the plants didn’t carry the transgene but derived from the same T0 regenerated plant so that they may also be subjected to mutations introduced by tissue culture). All the non-transgenic seeds didn’t show any decrease compared to the wild type after 26-month storage (Fig. S8 in Supporting Information 2). Thus, the decreased seed longevity of the OE-sLOX3 seeds most likely resulted from the enhanced sLOX3 activity. Similar results were obtained in another independent experiment, in which the seeds from T2 plants were subjected to accelerated aging treatment (stored at 40oC, 80%RH) instead of natural aging (Fig. S9 in Supporting Information 2). In all, our data indicated that sLOX3 has a negative effect on seed longevity.
J. Plant Biol. (2013) 56:232-242
Overexpression of sLOX3 Increases Occurrences of Seed Embryo Decay Occasionally, in dehulling the seeds routinely stored for 26 months (from the same batch of seeds used in the germination test) we observed that the stored OE-sLOX3 seeds had a higher frequency of embryo decay occurrences than did the wild type (see Fig. S10 in Supporting Information 2 for image of seeds with decayed embryos). Thus, we carefully examined the samples (including the transgenic seeds, their non-transgenic counterparts and the wild type) and recorded the percentage of the decayedembryo seeds. The statistic data indeed indicated that there were a much higher frequency of embryo decay occurrences for the OE-sLOX3 seeds (Fig. 7D), which indicated that sLOX3 promoted seed embryo decay. Obviously, the increased occurrence of embryo decay should partially explain the decrease of seed longevity in the OE-sLOX3 rice.
Discussion In the present research, we indicated that Os03g0700400 encodes sLOX3. Our independent work confirmed the previous result of Shirasawa and co-workers (2008), who identified Os03g0700400 as sLOX3 through a different strategy. We also validated the previous researchers’ finding that sLOX3 absence in the sLOX3-null variety “Daw Dam” was caused by a loss-of-function mutation of the sLOX3 gene. Beyond this, we further indicated that multiple sLOX3-null varieties share the same mutation in the Os03g0700400 gene leading to sLOX3 absence, suggesting a common origin of the mutated sLOX3 genes in the varieties. In addition, in this study, we prokaryotically expressed Os03g0700400 and characterized the biochemical properties of the recombinant protein. Our result indicated that Os03g0700400 was indeed a 9-LOX and revealed that the recombinant protein was easily prepared and may be applied to specifically generate 9(S)-HPOD(T), which may be used for the biochemical production of many substances having experimental or industrial uses (such as fragrances including nonenal and nonadienal with cucumber-like odor). Like other 9-LOX proteins (Andreou and Feussner 2009), sLOX3 is indicated to be cytosolic. Although the protein was originally isolated from the seed, the highest sLOX3 expression was found in the root, about four times as high as that in the embryo (21 d old). Previous studies indicate that the 9-LOX pathway is involved in the plant resistance to microbial pathogens. For instance, antisense suppression of a tobacco 9-LOX gene results in loss of the resistance to a fungal pathogen Phytophthora parasitica (Rance et al. 1998). Similarly, knockout mutants of 9-LOX (AtLOX1 or
237
both AtLOX1 and AtLOX5) in Arabidopsis show enhanced susceptibility to a bacterial pathogen Pseudomonas syringae pv. Tomato (Lopez et al. 2011; Vicente et al. 2011). It is also indicated that 9-LOX-derived oxylipins may serve as regulator of root development. Vellosillo et al. (2007) demonstrate that hydroxyoctadecatrienoic acid (9-HOT), or a closely related 9-LOX product, is an endogenous modulator of lateral root formation in Arabidopsis. Gao et al. (2008) also show that mutation of ZmLOX3, a 9-LOX gene, leads to reduced seed root elongation in maize. Based on previous studies, we suppose that with high expression in the root sLOX3 may play important roles in root development and defense. Further studies are needed to elucidate its roles. Most importantly, our study demonstrated that sLOX3 negatively affected seed longevity, but what is the underlying mechanism? One possibility is that sLOX3 stimulates lipid peroxidation in the seed, leading to seed deterioration. Indeed, Suzuki and co-workers (1999) found that the raw brown rice of sLOX3normal cultivars generated more volatiles including hexanal, pentanal and pentanol (the end products of lipid deterioration) than did the sLOX3-null counterparts during storage at 35oC. Therefore, sLOX3 may have a significant effect on lipid peroxidation in the stored rice seeds. However, conflicting results were obtained by Trawatha and co-workers using soybean seeds as materials (Trawatha et al. 1995). The researchers found that the loss of one or two of the three seed LOX members have no effect on soybean seed deterioration including the production of six-carbon aldehydes. In the present study, the seeds used in the germination test were also determined for the levels of the end products of lipid deterioration including pentanol, hexanal, hexanol and hexanoic acid. Unexpectedly, none of OE-sLOX3 seeds showed a higher level of these volatiles compared to their individual non-transgenic control and the wild type (Fig. S11 in Supporting information 2). The same case was also observed for other volatiles including acetone, n-heptanal, 1-heptanol, n-octanal, 1-octanol, n-nonanal, 1nonanol and n-decanal (data not shown). Consistent with the results obtained by Trawatha and co-workers who used soybean seeds as materials, our result did not support a significant role of sLOX3 in lipid deterioration in the intact dry rice seed. Although whether sLOX3 has a significant effect on lipid peroxidation in undamaged rice seed tissues is debatable (it is also not an issue to be resolved in the present study), our data suggested that the reduction of seed longevity caused by sLOX3 overexpression was quite unlikely to be a consequence of promoted lipid deterioration. Another possibility is that sLOX3 stimulates colonization of particular pathogens in the rice seed. The idea was prompted by the increased occurrence of embryo decay in the OE-sLOX3 seeds. Firstly, the seed embryo decay was
238
most likely to be a consequence of microbial activities. As reported, there are certain mycotoxigenic fungi such as Aspergillus flavus and A. parasiticus, which preferentially colonize oil seeds such as peanuts, cottonseeds and tree nuts (Diener et al. 1987). When these fungi infect starchy seeds such as maize kernels, they display preferential colonization of oil-rich tissues such as embryo and aleurone (Brown et al. 1993; Keller et al. 1994). Rice grains, embryos of which are rich in oil, may also be infected by the fungi prior to harvest or during storage (Miller 1995; Reddy et al. 2008). Infestation of the pathogens in rice seeds may lead to decrease or loss in seed viability or to overall decay of embryo. Secondly, 9-oxylipins, metabolites of 9-LOX pathway, are thought to facilitate pathogenesis (i.e., production of spores and mycotoxins) of some fungi (Gao and Kolomiets 2009; Christensen and Kolomiets 2011). The compelling genetic evidence supporting this concept was provided by a study of maize knockout mutant of a 9-LOX gene, ZmLOX3 (Gao et al. 2007). Lox3 mutants, which have lesser 9-oxylipins relative to the wild type, displayed reduced levels of conidiation and production of the mycotoxin fumonisin B1 in the kernels infected by the fungal pathogen Fusarium verticillioides. In addition, lox3 mutants are more resistant to several stalk and root rots as well as to two foliar pathogens (Gao et al. 2007; Isakeit et al. 2007). The rice sLOX3, also a 9-LOX, may play similar roles in the rice seed-fungal interaction as ZmLOX3 does. Therefore, overexpression of sLOX3 may promote infection of particular fungal pathogens in the rice seed and lead to increased occurrence of embryo decay. However, the hypothesis should be validated in further studies. If our hypothesis is correct, it is easy to interpret why the sLOX3-null varieties identified by Suzuki and co-workers (2000) and in our research are distributed in a limited area covering Yunnan province of China, Vietnam, Laos, Thailand and Myanmar. The dampness and hotness of the environmental conditions in the area mentioned are quite suitable for the growth of mould fungi and other pathogens which are quite adverse to rice seed storage. In this situation, the loss-of-function mutation of sLOX3 may benefit the rice seed itself or the farmers who selected and kept growing the mutants by reducing infestation of particular fungi.
Materials and Methods Plant Materials and Growth Conditions “Daw Dam” and “PL2” are a Javanica variety of Thailand and a Japonica cultivar respectively, both lacking sLOX3. IRBB7, 9311 and Wuyunjing 7 are sLOX3-normal cultivars (The former two are indica and the latter is japonica). The
J. Plant Biol. (2013) 56:232-242
parents and the mapping population were grown in 2001, 2003, and 2004, Nanjing, China. T1 transgenic plants of were grown in 2009, Nanjing. T2 plants were grown during the period from May to October of 2011 in Nanjing. Seeds harvested were dried at 50oC for three days prior to use. Color Test for the Determination of sLOX3 Presence or Absence in Rice Seeds To screen genetic resources for sLOX3-null varieties, a simple and inexpensive method based on the one used in soybean LOX mutant screening (Hammond et al. 1992) was developed in our lab (Shen et al. 2002). The presence or absence of sLOX3 in one seed can be detected by only one color test described as follows: a piece of embryo tissue from one seed placed in a 1.5 mL centrifuge tube was added with 500 µL of 0.2 M Na2B4O7-H3BO3 buffer (pH 8.2) and incubated at room temperature for 1 h to make enzymes released. The solution was then added with another 500 µL of 0.2 M Na2B4O7-H3BO3 buffer (pH 8.2) containing 0.2 mM sodium linoleate and 0.01% tween-20 and incubated at room temperature for 10 min. The solution was further added with 100 µL of freshly-prepared acidic KI solution (saturated KI:15% HAC, 5:95,V/V) and 100 µL of 0.4 M Na2B4O7-H3BO3 buffer (pH 9.0) containing 1% soluble starch and mixed. The resulting mixture was stored at 25oC for about 10 h in the dark. If the seed is sLOX3 normal, a precipitated dark purple iodine-starch mixture was formed. If the seed is sLOX3 null, only a white or a very light purple color is formed. In every test, setting both a negative (such as a “Daw Dam” seed) and a positive (such as a “Nipponbare” seed) control is necessary. The principle of the method is: lipid hydroperoxides produced by LOX may oxidized I−1 ions to form I2, which may react with starch to form colored substances; at a basic pH at 8.2 or higher, the rice seed with all members of LOXs still maintain an activity to produce enough lipid hydroperoxides for the color formation, but the one lacking sLOX3 cannot accomplish this. Genetic Analysis Genomic DNA of individual F2 plants was used in linkage analysis with available RFLP and SSR markers (McCouch et al. 2002; Wu et al. 2002) as well as SSR markers developed in this study. New SSR markers were produced from the publicly available rice genome sequence of Nipponbare by using the Primer 5 and SSRIT procedures (http://www. gramene.org/db/searches/ssrtool) (Temnykh et al. 2001). The polymorphism between the parents was predicted by comparing sequences from Nipponbare and the indica cultivar, 9311 (http://rice.genomics.org.cn/rice/index2.jsp). Sequences of key primers closely linked with sLOX3/slox3 are listed in
J. Plant Biol. (2013) 56:232-242
Table S2 in Supporting Information 1. The bands of the PCR products of one key marker in silver-stained PAGE (polyacrylamide gel electrophoresis) gel were also shown in Fig. S3 in Supporting Information 1. Linkage analysis was performed with software MAPMAKER/EXP 3.0 (Lincoln et al. 1993). RT-PCR Analysis Total RNA of leaves, sheaths, stems, panicles and roots was extracted using TRIzol reagent (DingGuo Co. Ltd., Beijing, China) following the manufacturer’s instructions. RNA extraction on embryos was performed with RNAplant Plus reagent (Tiangen Biotech Co. Ltd., Beijing, China). Firststrand cDNA was reverse transcribed from total RNA with oligo(dT)18 as primers. The level of gene expression was analyzed by quantitative PCR (qPCR) using OsEF-1α (NM_001055681) as internal normalization control. PCR was carried out in a total volume of 25 µL with the reagent SYBR® Green Realtime PCR Master Mix (Toyobo Co. Ltd., Shanghai, China). Primers used in realtime PCR are as follows: 5'-GCCCAGCCGAGTTCCCATAC (sLOX3-forward), 5'-GGTATCCACACAACGCTAATCTCTC (sLOX3-reverse), 5'-TCTTCCCCTTCAGGACGTGT (OsEF-1α-foward), 5'-GGACCAAAGGTCACCACCAT (OsEF-1α-reverse); amplicon length for sLOX3 and OsEF-1α is 208 and 103 bp, respectively. PCR was performed with an ABI 7500 cycler using the following program: 95oC for 30 sec, then 40 cycles of 95oC for 5 sec, 60oC for 15 sec, and 72oC for 34 sec, followed by a dissociation step for the analysis of product melting temperature. Expression levels are expressed as the abundance ratio of sLOX3/OsEF-1α with the hypothesis that both genes have an amplification efficiency of 2. Prokaryotic Expression and Enzymatic Analysis cDNA including the CDS of sLOX3 was amplified from reverse-transcribed total RNA of embryos with the following primers: 5'-ggatcc AAGATGCTGGGAGGGATCATC (forward; with BamHI site), 5'-GATTAAGATCGGGAGCTCAGATTT (reverse). PCR reaction was carried out in a total volume of 50 µL containing 5 µL 10×LA PCR Buffer II (Mg2+ Plus), 8 µL dNTPs (2.5 mM), 0.5 µL Takara LA Taq (5 U µL−1), 2 ìl primers (20 µM), 5 µL first-strand cDNA and 29.5 µL water. PCR temperature program is as follows: 95oC for 2 min, then 35 cycles of 98oC for 10 sec, 60oC for 30 sec, and 72oC for 3 min. The fragment obtained was cloned into TAcloning vector pMD18-T (Takara Co. Ltd., Dalian, China) and only clones with the fragment inserted in the direction as that of lacZ in the vector were selected. After sequencing, the BamHI-HindIII fragment was subcloned into prokaryotic expression vector pET-30a. Recombinant proteins (with His
239
tag at the N terminus) of sLOX3 was produced in E. coli strain BL21 (DE3) induced with 1 mM isopropyl β-D-1thiogalactopyranoside (IPTG) at 16oC. Bacterial cells having expressed the protein were harvested by centrifuge and were subjected to mechanical disruption through sonication (SonicsTM VC750, the USA). The lysate was centrifuged and the supernatant was used as crude enzyme. One can refer to the Novagen brochure pET System Manual 11th Edition for detailed procedures of prokaryotic expression. The crude enzyme was partially purified with a His•Bind® Purification Kit of Novagen® (Merck, Germany) according to the manufacturer’s instructions. LOX activity was determined in 3 mL buffer containing 0.33 mM sodium linoleate, 0.013% Tween-20, 5-30 µL crude enzyme solution. Analysis of Enzymatic Products of Recombinant sLOX3 For preparation of enzymatic products of recombinant sLOX3, the enzymatic reaction was conducted in 30 mL solution containing 0.33 mM sodium linoleate or sodium linolenate, 500 µL partially purified recombinant sLOX3 protein solution and 0.1 M NaH2PO4-Na2HPO4 (pH 6.5) and the solution was incubated at 28oC for 0.5 h under 100 rpm agitation. The reaction was terminated by adjusting pH of the solution to 2.0-3.0 with concentrated hydrochloric acid. Hydroperoxides in the solution were extracted with 30 mL HPLC grade hexane. After rigorously shaking, the organic phase was collected and dried with anhydrous Na2SO4. The resulting solution was directly used for high performance liquid chromatography (HPLC) analysis. Standard sample of hydroperoxides of linoleic acid and linolenic acid including 9(S)-hydroperoxy-10(E),12(Z)-octadecadienoic acid [9(S)HPOD], 13(S)-hydroperoxy-9(Z),11(E)-octadecadienoic acid [13(S)-HPOD], 9(S)-hydroperoxy-10(E),12(Z),15(Z)-octadecatrienoic acid [9(S)-HPOT] and 13(S)-hydroperoxy9(Z),11(E),15(Z)-octadecatrienoic acid [13(S)-HPOT] (Larodan Fine Chemicals, Sweden) originally dissolved in 90% ethanol was dried under N2 and re-dissolved in hexane for HPLC analysis. HPLC analysis was performed in a Waters HPLC equipment. Fifteen-microliter solution of sample and standard was loaded. The HPLC columns and conditions were similar to those described in the study of Liu and Han (2010). Protoplast Isolation, Transformation and Microscopy To transiently express sLOX3 in protoplasts, the CDS region omitting the stop codon of the gene was amplified from a plasmid inserted with sLOX3 cDNA sequence using the following primers: aattctagaATGCTGGGAGGGATCATCGACAC (forward; with XbaI site and protective bases), aatggatccGATCGAGATGCTGTTGGGGATG (reverse; with BamHI site and protective bases). The PCR products were
240
cut with XbaI and BamHI, purified and cloned into transient expression vector pAN580 (http://www.bio.utk.edu/cellbiol/ markers/vectors.htm). The resulting vector allows expressing a chimeric protein with GFP fused at the C terminus of sLOX3 in plant cells. Protoplasts isolated from nine days old seedlings were used for transient expression analysis. Protoplast isolation and transformation was performed according to the method of Zhang et al. (2011). Subcellular location of the chimeric protein in the protoplast was examined by laser scanning confocal microscopy using the Zeiss 710 system. GFP was excitated at 488 nm wavelengths. The emission filter was 500-530 nm for GFP. Chlorophyll autofluorescence was monitored using 488 nm excitation wavelengths and 650-750 nm detection windows. Generation of Transgenic Plants The BamHI-HindIII fragment in TA-cloning vector inserted with sLOX3 cDNA was subcloned into the binary vector pPZPH2a3 (+) (Fuse et al. 2001). The vector was introduced into Agrobacterium strain EHA101, and the transformed bacteria were used to transform calli of Wuyunjing 7 and PL2 by the method of Hiei and co-workers (1994). Hygromycin was used for screening resistant transformed calli. Integration of the T-DNA into the genome of regenerated plants was confirmed by PCR amplification of the sLOX3 cDNA using primers: 5'-GGCTCCCCCGACACCCCCTACC (forward), and 5'-GCCGGCGTTGATGAGCGTCTGC (reverse) and by seed germination in 50 µg mL−1 hygromycin solution. Determination of Seed LOX Activity Crude LOX enzymes were extracted from rice bran (mixture of embryos and endosperm outer layers) through the following procedure: 0.2 g rice bran were extracted with 1.5 mL 0.05 M NaH2PO4-Na2HPO4 buffer (pH 7.6) in a 2.0 mL centrifuge tube under shaking with a period of 1/30 S on a Mixer Mill (Retsch MM301, Germany) for 2 × 5 min. The plate for holding the tube were precooled to -20oC and the extraction buffer to 4oC. The resulting slurry was added with 0.246 g ammonium sulfate to 30% saturation. After centrifugation at 12,000 g for 5 min, the supernatant (1.0 mL) was collected and added with ammonium sulfate to 60% saturation. After centrifugation at 12.000 g for 5 min, the supernatant was discarded and the pellet was solvated with 0.6 mL 0.05 M NaH2PO4-Na2HPO4buffer (pH 7.6). Protein content was determined with Bradford method. LOX activity was determined at 30oC in 200 µL solution containing 0.33 mM sodium linoleate, 0.013% Tween-20, 0.1 M NaH2PO4Na2HPO4 buffer (pH 6.5) and crude enzymes of approximately 100 µg total proteins. The absorbance at 234 nm was recorded
J. Plant Biol. (2013) 56:232-242
using a SpectraMax® Plus 384 microplate spectrophotometer (Molecular devices, the USA). Before each reading, a shaking for 3 sec was performed. The absorbance only within 5-20 min was used for LOX activity calculation. The activity was expressed as ∆A234 min−1 mg−1. Germinating Test Fifty seeds were placed in a plastic Petri dish (with a diameter of seven centimeter) including three layers of filter papers at the bottom. The seeds were then supplied with ample water and kept at 30oC for 48 h to allow thorough imbibition. After that, the water was discarded. After being washed with running water for several times, the seeds were left on the wet filter papers in the Petri dish to germinate at 30oC. Germination frequency was recorded three and seven days after imbibition. The coleoptile breaking though the hull was taken as germinating.
Acknowledgements We sincerely thank Shouan Liu at Tea Research Institute of Chinese Academy of Agricultural Sciences for his generous help in HPLC analysis. This research is supported by the National Transform Science and Technology Program (2011ZX08001-006)
Supporting Information Fig. S1. Illustration of the fine mapping for the sLOX3/slox3 locus Fig. S2. Further confirmation of the fine mapping result of slox3 using F2 population of “PL2/9311” Fig. S3. Image of a typical color test result for sLOX3 presence or absence in the embryo Fig. S4. Silver-stained PAGE gel showing segregation of SSR3-183 in F2 population of “Daw Dam/IRBB7” Fig. S5. LOX activity of crude recombinant Os03g0700400 protein expressed in Escherichia coli relative to the control Fig. S6. HPLC analysis of hydroperoxides formed from linolenic acid by recombinant Os03g0700400 Fig. S7. Illustration of the T-DNA construct for overexpressing sLOX3 in the rice plants and PCR detection of the transgene in the transformed plants Fig. S8. Germination frequency of non-transgenic control seeds of OE-sLOX3 lines compared with the wild type Fig. S9. Effect of sLOX3 overexpression on seed longevity assessed through accelerated aging test (40oC, 80% RH) Fig. S10. Image of seeds with decayed embryos Fig. S11. Effect of sLOX3 overexpression on production of staleflavor volatiles in stored rice seeds Table S1. Segregation of sLOX3 presence and absence in F2 population Table S2. Markers closely linked with slox3
References Andreou A, Feussner I (2009) Lipoxygenases - Structure and reaction
J. Plant Biol. (2013) 56:232-242
mechanism. Phytochemistry 70:1504−1510 Brown RL, Cotty PJ, Cleveland TE, Widstrom NW (1993) Living maize embryo influences accumulation of aflatoxin in maize kernels. J Food Prot 56:967-971 Chikubu S (1970) Stale flavor of stored rice. Jpn Agr Res Q 5:63−68 Christensen SA, Kolomiets MV (2011) The lipid language of plantfungal interactions. Fungal Genet Biol 48:4−14 Diener UL, Cole RJ, Sanders TH, Payne GA, Lee LS, Klich MA (1987) Epidemiology of aflatoxin formation by Aspergillus flavus. Annu Rev Phytopathol 25:249−270 Feussner I, Wasternack C (2002) The lipoxygenase pathway. Annu Rev Plant Biol 53:275−297 Fuse T, Sasakh T, Yano M (2001) Ti-plasmid vectors useful for functional analysis of rice genes. Plant Biotechnol 18:219−222 Gao X, Kolomiets MV (2009) Host-derived lipids and oxylipins are crucial signals in modulating mycotoxin production by fungi. Toxin Rev 28:79−88 Gao X, Shim WB, Gobel C, Kunze S, Feussner I, Meeley R, BalintKurti P, Kolomiets M (2007) Disruption of a maize 9lipoxygenase results in increased resistance to fungal pathogens and reduced levels of contamination with mycotoxin fumonisin. Mol Plant Microbe Interact 20:922−933 Gao X, Starr J, Gobel C, Engelberth J, Feussner I, Tumlinson J, Kolomiets M (2008) Maize 9-lipoxygenase ZmLOX3 controls development, root-specific expression of defense genes, and resistance to root-knot nematodes. Mol Plant Microbe Interact 21:98−109 Grechkin A (1998) Recent developments in biochemistry of the plant lipoxygenase pathway. Prog Lipid Res 37:317−352 Hammond EG, Duvick DN, Fehr WR, Hildebrand DF, Lacefield EC, Pfeiffer TW (1992) Rapid screening techniques for lipoxygenases in soybean seeds. Crop Sci 32:820−821 Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6:271−282 Horton P, Park KJ, Obayashi T, Fujita N, Harada H, Adams-Collier CJ, Nakai K (2007) WoLF PSORT: protein localization predictor. Nucleic Acids Res 35:W585−587 Hua S, Sun Z (2001) Support vector machine approach for protein subcellular localization prediction. Bioinformatics 17:721−728 Ida S, Masaki Y, Morita Y (1983) The isolation of multiple forms and product specificity of rice. Agric Biol Chem 47:637−641 Isakeit T, Gao X, Kolomiets M (2007) Increased resistance of a maize mutant lacking the 9-lipoxygenase gene, ZmLOX3, to root rot caused by Exserohilum pedicellatum. J Phytopathol 155:758−760 Keller NP, Butchko RAE, Sarr B, Phillips TD (1994) A visual pattern of mycotoxin production in maize kernels by Aspergillus spp. Phytopathol 84:483−488 King JM, Chin SM, Svendsen LK, Reitmeier CA, Johnson LA, Fehr WR (2001) Processing of lipoxygenase-free soybeans and evaluation in foods. J American Oil Society 78:353−360 Lincoln SE, Daly MJ, Lander ES (1993) Constructing genetic linkage maps with MAPMAKER/EXP Version 3.0: a tutorial and reference manual. A Whitehead Institute for Biomedical Research Technical Report Liu S, Han B (2010) Differential expression pattern of an acidic 9/13lipoxygenase in flower opening and senescence and in leaf response to phloem feeders in the tea plant. BMC Plant Biol 10:228 Loiseau J, Vu BL, Macherel M-H, Deunff YL (2001) Seed lipoxygenases: occurrence and functions. Seed Sci Res 11:199− 211 Lopez MA, Vicente J, Kulasekaran S, Vellosillo T, Martinez M, Irigoyen ML, Cascon T, Bannenberg G, Hamberg M, Castresana C (2011) Antagonistic role of 9-lipoxygenase-derived oxylipins
241
and ethylene in the control of oxidative stress, lipid peroxidation and plant defence. Plant J 67:447−458 Malekian F, Rao RM, Prinyawiwatkul W, Marshal WE, Windhauser M, Ahmedna M (2000) Lipase and lipoxygenase activity, functionality and nutrient losses in rice bran during storage. Louisiana Agricultural Experimental Station, LSU Agriculture Centre, Baton Rouge, LA 70894-5055; Bulletin No 870, 1−68 McCouch SR, Teytelman L, Xu Y, Lobos KB, Clare K, Walton M, Fu B, Maghirang R, Li Z, Xing Y, Zhang Q, Kono I, Yano M, Fjellstrom R, DeClerck G, Schneider D, Cartinhour S, Ware D, Stein L (2002) Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.). DNA Res 9:199−207 Miller JD (1995) Fungi and mycotoxins in grain: implications for stored product research. J Stored Prod Res 31:1−16 Mosblech A, Feussner I, Heilmann I (2009) Oxylipins: Structurally diverse metabolites from fatty acid oxidation. Plant Physiol Biochem 47:511−517 Ohta H, Ida S, Mkami B, Morita Y (1986) Purification and characterization of rice lipoxygenase component 3 from embryos. Agric Biol Chem 50:3165−3171 Ohyanagi H, Tanaka T, Sakai H, Shigemoto Y, Yamaguchi K, Habara T, Fujii Y, Antonio BA, Nagamura Y, Imanishi T, Ikeo K, Itoh T, Gojobori T, Sasaki T (2006) The Rice Annotation Project Database (RAP-DB): hub for Oryza sativa ssp. japonica genome information. Nucleic Acids Res 34 (Database issue): D741−744 Porta H, Rocha-Sosa M (2002) Plant lipoxygenases. Physiological and molecular features. Plant Physiol 130:15−21 Ramezanzadeh FM, Rao RM, Windhauser M, Prinyawiwatkul W, Marshall WE (1999) Prevention of oxidative rancidity in rice bran during storage. J Agric Food Chem 47:2997−3000 Rance I, Fournier J, Esquerre-Tugaye MT (1998) The incompatible interaction between Phytophthora parasitica var. nicotianae race 0 and tobacco is suppressed in transgenic plants expressing antisense lipoxygenase sequences. Proc Natl Acad Sci USA 95:6554−6559 Reddy KRN, Reddy CS, Abbas HK, Abel CA, Muralidharan K (2008) Mycotoxigenic fungi, mycotoxins, and management of rice grains. Toxin Rev 27:287−317 Robinson DS, Wu Z, Domoneyb C, Casey R (1995) Lipoxygenases and the quality of foods. Food Chem 54:33−43 Shastry BS, Rao MRR (1975) Studies on lipoxygenase from rice bran. Cereal Chemistry 52:597−603 Shen WB, Zhou T, Wang YH, Zheng TQ, Zhai HQ, Wan JM (2002) One simple and rapid spectrophotometric method for screening of lipoxygenase-3-null in rice embryos. Rice Genetics Newsletter 19:52−53 Shirasawa K, Takeuchi Y, Ebitani T, Suzuki Y (2008) Identification of gene for rice (Oryza sativa) seed lipoxygenase-3 involved in the generation of stale flavor and development of SNP markers for lipoxygenase-3 deficiency. Breeding Sci 58:169−176 Suzuki Y, Ise K, Li C, Honda I, Iwai Y, Matsukura U (1999) Volatile components in stored rice [Oryza sativa (L.)] of varieties with and without lipoxygenase-3 in seeds. J Agric Food Chem 47:1119−1124 Suzuki Y, Ise K, Nagamine T (2000) Geographical variation of the gene, (lox3(t)), causing lipoxygenase-3 deficiency in Asian rice varieties. Rice Genetics Newsletter 17:13 Suzuki Y, Nagamine T, Kobayashi A, Ohtsubo K (1993) Detection of a new rice variety lacking lipoxygenase-3 by monoclonal antibodies. Japan J Breed 43:405−409 Suzuki Y, Nagamine T, Okuno K (1996) Genetic analysis of a nullallele for lipoxygenase-3 in rice seeds. Euphytica 91:99−101 Temnykh S, DeClerck G, Lukashova A, Lipovich L, Cartinhour S, McCouch S (2001) Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential.
242
Genome Res 11:1441−1452 Trawatha SE, TeKrony DM, Hildebrand DF (1995) Soybean lipoxygenase mutants and seed longevity. Crop Sci 35:862−868 Vellosillo T, Martinez M, Lopez MA, Vicente J, Cascon T, Dolan L, Hamberg M, Castresana C (2007) Oxylipins produced by the 9lipoxygenase pathway in Arabidopsis regulate lateral root development and defense responses through a specific signaling cascade. Plant Cell 19:831−846 Vicente J, Cascon T, Vicedo B, Garcia-Agustin P, Hamberg M, Castresana C (2011) Role of 9-lipoxygenase and alphadioxygenase oxylipin pathways as modulators of local and systemic defense. Mol Plant 5:914−928 Wang R, Shen W, Liu L, Jiang L, Liu Y, Su N, Wan J (2008) A novel lipoxygenase gene from developing rice seeds confers dual
J. Plant Biol. (2013) 56:232-242
position specificity and responds to wounding and insect attack. Plant Mol Biol 66:401−414 Wu J, Maehara T, Shimokawa T, Yamamoto S, Harada C, Takazaki Y, Ono N, Mukai Y, Koike K, Yazaki J, Fujii F, Shomura A, Ando T, Kono I, Waki K, Yamamoto K, Yano M, Matsumoto T, Sasaki T (2002) A comprehensive rice transcript map containing 6591 expressed sequence tag sites. Plant Cell 14:525−535 Yamamoto A, Fujii Y, Yasumoto K, Mitsuda H (1980) Partial purification and study of some propertices of rice germ lipoxygenase. Agric Biol Chem 44:443−445 Zhang Y, Su J, Duan S, Ao Y, Dai J, Liu J, Wang P, Li Y, Liu B, Feng D, Wang J, Wang H (2011) A highly efficient rice green tissue protoplast system for transient gene expression and studying light/chloroplast-related processes. Plant Methods 7:30