Molecular Biology Reports 29: 347–352, 2002. © 2002 Kluwer Academic Publishers. Printed in the Netherlands.
347
Potential protein partners for the N-terminal domain of human topoisomerase I revealed by phage display Agata M. Trzci´nska, Agnieszka Girstun, Agnieszka Piekiełko, Barbara Kowalska-Loth & Krzysztof Staro´n∗ Institute of Biochemistry, Warsaw University, ul. Miecznikowa 1, 02-093 Warsaw, Poland; correspondence (Phone: +48 22 5543114; Fax: +48 22 5543116; E-mail:
[email protected])
∗ Author
for
Accepted 15 July 2002
Key words: partner proteins, phage display, topoisomerase I
Abstract Phage display procedure was applied to the N-terminal domain of human topoisomerase I. The consensus sequence identified for clones binding to the N-terminal domain was found in 35 human proteins that are either permanently or temporarily located in the nucleus. They are in majority involved in the DNA repair, transcription, RNA metabolism or cell cycle control. Four of identified proteins: Bub3 protein, Cockayne syndrome protein A, damaged DNA binding protein 2 and GRWD protein belong to WD-repeat proteins and their sequences recognized by the N-terminal domain are identically localized. Abbreviations: DHFR – dihydrofoliate reductase; htopo I – human topoisomerase I; htop(1-214) – polypeptide comprised of the first 214 amino acids of human topoisomerase I. Introduction Human topoisomerase I (htopo I) is the main enzyme responsible for relaxing DNA supercoils [1] and a protein kinase specific for SR proteins [2]. Htopo I may also be involved in regulation of initiation of transcription by RNA polymerase II [3]. Htopo I is a single polypeptide composed of 765 amino acids residues. The fragment comprised of the first 214 amino acids residues, called the N-terminal domain, is not essential for relaxing activity [4] but is considered as a main region of htopo I that binds proteins [5]. It includes a binding site for substrate proteins phosphorylated by htopo I/kinase [6] and binds nucleolin [7], SV40 large T antigen [8], p53 [9], TATA-binding protein [10] and RING/SR proteins called topors [11]. Two proteins, BTBD1 and BTBD2, have recently been shown to bind outside the N-terminal domain [12]. Several other proteins: PSF/p54nrb [13], protein kinase CK2 [14], proliferation cell nuclear antigen [15] and poly(ADPribose) polymerase I [16] also bind to htopo I although the exact binding region has not yet been established.
Another two proteins, called tof1 and tof2, have been shown to bind to yeast topo I [17]. Recent findings demonstrate that htopo I is fully mobile in vivo and most likely remains free for transient interactions with other proteins in the nucleus [18]. This suggests that htopo I may potentially interact with any protein present in this compartment if the protein contains an amino acids motif recognized by htopo I. Up to now, no motif that binds to htopo I with high affinity has been identified. To address this problem we employed a phage display procedure for identification of amino acids sequences recognized by the N-terminal domain of htopo I. In this report we present several proteins that could be potential partners of htopo I.
348 Materials and methods
Table 1. The amino acids sequences present in 16 phage clones that interact with the N-terminal domain of htopo I.
Expression and purification of htop(1-214) The 5 region of cDNA, coding for the Nterminal domain of htopo I, was amplified by PCR from the pQE30 based plasmid (Qiagen), containing the fragment of htopo I cDNA corresponding to the first N-terminal 483 amino acids of human topo I. Oligo pairs: TTCATTAAAGAGGAGAAAACT and GTTCAAGCTTGCCTTCAGGATAGCGCTC were used. The identity of the PCR product was confirmed by DNA sequencing. The product was ligated into BamHI and HindIII sites of pQE30 expression vector (Qiagen). Htop(1214) polypeptide coded by this plasmid contained amino acids 1-214 of htopo I and additionally 6 His tag coming from the pQE30 vector at its N-terminal end. Htop(1-214) was overexpressed in E. coli strain M15 (Qiagen) and extracted from bacterial cells under native conditions according to Qiagen instruction. Cleared lysate was put on heparine agarose column and eluted with 700 mM NaCl, 7 mM 2mercaptoethanol, 20 mM Tris-HCl, pH 8. The eluate was subjected to chromatography on Ni-NTA agarose according to Qiagen instruction. SDS electrophoresis and Western blotting of protein preparations were performed according to [19]. Anti-His (Qiagen) and anti-htopo I (TopoGEN) antibodies were used for identification of htop(1-214). Expression and purification of DHFR To express His-tagged DHFR the pQE-40 plasmid (Qiagen) was used. Expression and purification of the protein was performed according to Qiagen instruction. Phage display Ph.D.-7TM kit (New England Biolabs, Inc.) containing complete linear 7-mer peptide library was used in all phage display experiments according to the producer instruction. Before applying phage display library to htop(1-214) prepanning step was performed with albumin (100 µg/ml) as a target.
Results and discussion To be sure of specificity of interactions revealed by phage display procedure we first tested identity and
Amino acids sequence
Number of clones
KLWVIPQ KLWVLPK KLWQVFP KVWILTP KVWTIPR KVWYITP KCCYIPT KGPPITR KVWDLRS YVTREPR
3 2 1 1 1 1 4 1 1 1
purity of htop(1-214). SDS electrophoresis of htop(1214) preparation revealed only a single band if stained with Coomassie blue (Figure 1). Molecular weight of the band corresponded to that calculated for htop(1214). The band was recognized by anti-His and antihtopo I antibodies (not shown). The 3rd round of panning of the phage display procedure applied to htop(1-214) revealed several positive clones. None of the clones gave a positive reaction with His-tagged DHFR indicating this way that the clones did not bind to the tag sequence added to htop(1-214) to facilitate purification of the polypeptide. The amino acids sequences of 16 randomly selected clones are shown in Table 1. Considering that several sequences were repetitions of the same clone we identified 9 different sequences. The consensus sequence established on this basis was as follows: KBWXB(P, T, R, F)X, where B and X mean hydrophobic and any residue, respectively. The consensus sequence revealed by phage display procedure was used for identification of the best matches on possible protein partners. A search of SWISS-PROT database, using FASTA and BLASTP, allowed us to identify 124 human proteins that contain an exact match of the consensus. 25 of them are exclusively nuclear proteins and additional 10 may temporarily be located in this compartment. Looking for potential protein partners for htopo I among the two latter groups we took into consideration proteins that were involved in processes linked with htopo I activities, interacted with known htopo I partners and
349
Table 2. Nuclear and temporarily nuclear proteins containing the consensus sequence recognised by the N-terminal domain of htopo I Protein
Damaged DNA Binding Protein 2 (DDB2) Cockayne Syndrome WDrepeat Protein A (CSA) Serine-protein kinase ATM Interferon Regulatory Factor 4 (IRF4) BRCA1-associated Ring Domain Protein 1 (BAR1) ETS-related protein NET (ELK-3) TAR RNAbinding Protein 2 (TRBP) Trithorax-like Zinc Finger Protein (ALL-1/HRX) Interferon Consensus Sequence Binding Protein (ICSB) Transcriptional Regulator ISGF3 Gamma Subunit (IRTF) Ski-interacting Protein (SKIP) Splicing Factor 3b Subunit 1 (S3B1/SAP155) Polymyositis / Scleroderma Autoantigen 1 (PM/Scl 1) U1 Small Nuclear Ribonucleoprotein 70 kDa (Ru17/U1snRNP)
Location of the sequence in the protein
Cellular process in which the protein is involved
268 KIWDLRQ 274
DNA repair
212 KLWDVRR 218
DNA repair and transcription
486 KIWCITF 492
DNA repair and cell cycle control
72 KAWALFK 78
Transcription and other
754 KVWKAPS 760
Transcription and other
43 KLWGLRK 49
Transcription
171 KGWRLPE 177
Transcription
1523 KVWICTK 1529
Transcription
58 KAWAVFK 64
Transcription
60 KAWAIFK 66
Transcription and other
48 KGWIPRL 54
Transcription
252 KIWDPTP 258
RNA metabolism and other
112 KVWQIRV 118
RNA metabolism
185 KGWRPRR 191
RNA metabolism
350 Table 2. Continued U2 snRNP Auxiliary Factor Large Subunit (U2AF65) U6 snRNAassociated Sm-like Protein (LSM4) Gemin 4 (GEM4) Cell Division Protein Kinase 8 (Cdk8) Human Mitotic Checkpoint Protein (hBub3) 107 kDa Retinoblastoma – associated Protein (Rbl1) 130 kDa Retinoblastoma – associated Protein (Rbl2) Glutamate-rich WD-repeat Protein (GRWD) Symplekin (SPK) Tyrosine-protein kinase Jak1 70 kDa WD-repeat Tumor-Specific Antigen Homolog (W70T) DNA Ligase IV (DNL4) 55 kDa Regulatory Subunit of PP2A (2ABG) 72 kDa Tatinteracting Zinc Finger Protein (HT2A) Putative ATPdependent RNA Helicase (Y134/ KIAA0134) Recoverin (RECO) Glycogen Phosphorylase (PHS3)
90 KYWDVPP 96
RNA metabolism and other
52 KFWRMPE 58
RNA metabolism
710 KYWPLPK 716
RNA metabolism
92 KVWLLFD 98
Cell cycle control and transcription
121 KLWDPRT 127
Cell cycle control
819 KIWTCFE 825
Cell cycle control
867 KIWTCFE 873
Cell cycle control
333 KIWDLRQ 339
Cell proliferation
901 KVWEGFI 907
Differentiation marker
74 KLWYAPN 80
Signal pathway
103 KLWRLPG 109
Tumor antigen homolog
457 KYWKPFH 463
DNA ligase
116 KLWKITE 122
Regulatory subunit of protein phosphatase
471 KPWGITA 477 492 KLWCFTV 498
Biological activity of HIV-1 Tat protein
59 KFWTFFE 65
RNA helicase
153 KIWKYFG 159
Photoresponse
364 KAWEITK 370
Carbohydrate metabolism
351 Table 2. Continued Apoptotic Protease Activating Factor 1 (APAF-1) Colonic and Hepatic Tumor Over-expressed Protein (CTOG) Delta Tubulin (TBD) cAMP and cAMPinhibited cGMP 3 ,5 -cyclic Phosphodiesterase 10A (PDE 10A)
757 KLWDATS 763
Apoptosis
19 KLWKARL 25
Tumor over-expressed protein
412 KAWNMFA 418
A specialised microtubule system present during reshaping of the sperm head
670 KLWPVTK 676
Signal transduction
(or) had a common structure. List of identified nuclear proteins, their cellular functions and location of the consensus sequences in polypeptide chains are shown in Table 2. It also includes abbreviations of proteins’ names used in the text below. Three identified proteins are linked with DNA repair. DDB2 is a part of the complex involved in the repair of the UV-damaged DNA [20]. Recruitment of htopo I to DNA repair complex is precedented, because another complex involved in excision repair comprises poly(ADP-ribose) polymerase [21], that interacts with htopo I [16]. CSA is most possibly linked with transcription-coupled repair [22]. Protein kinase ATM is engaged in the cellular response to DNA damage [23]. ATM directly binds and phosphorylates p53 [24] which is also known to interact with htopo I [9, 10]. Large group of identified proteins is involved in transcription, similarly as it has been proposed for htopo I [3]. This group includes: interferon-responsive transcription factor [25], BRCA1-associated RING domain protein [26], protein Elk-3 [27], CSA [28], TAR RNA binding protein of HIV-1 [29] and zinc finger ALL-1 protein [30]. Another large group of identified proteins are participants of RNA metabolism considered here because of protein kinase activity of htopo I that is directed towards splicing proteins [2]. This group includes: spliceosomal protein 155 [31], RNase present in the nuclear exosome complex [32], U1snRNP protein 70K [33], U2AF65 protein [34] and Sm-like protein binding to snRNA [35]. The protein component of the exosome and U1 70K protein are,
Figure 1. SDS electrophoresis of htop(1-214) (lane 2). Lane 1: molecular weight markers. The gel was stained with Coomassie blue.
similarly to htopo I, recognized by sera from patients with scleroderma or lupus erythematosus [36]. Several identified proteins are involved in the cell cycle control: ATM kinase [37], cdk8 kinase [38], hBub3 protein [39] and retinoblastoma-like protein 1 [40]. The latter protein forms a complex with SV40 large T antigen [39], previously identified as htopo Iinteracting protein [8]. It is possible that the recognized sequence present in some proteins listed above is hidden inside the protein so that they have appeared in the group of potential proteins partners simply by chance. The more interesting is therefore the observation that four of identified proteins of different cellular functions
352 are built similarly one to the other. DDB2, hBub3, CSA and recently identified GRWD protein (Acc. no Q9BQ67) belong to WD-repeat proteins, known to be involved in assembling macromolecules [41]. Each protein contains 5 WD repeats and the sequence recognized by the N-terminal domain of htopo I is always present in the third but not other repeat. Based on the spatial model of another WD-repeat protein, βtransducin (PDB database, 1tbg chain c), one may find the motif homologous to that recognized by the Nterminal domain as accessible from the outside of the protein. Phage display procedure did not recognize any protein previously identified as interacting with the Nterminal domain of htopo I. One possible reason could be that the interaction with peptides containing the revealed consensus sequence was very strong and they were overrepresented among clones remaining after panning. In contrast, nucleolin has previously been shown to bind weakly to the N-terminal domain [7]. Another reason could be that interaction through the region other than binding to identified consensus sequence needs spatial structures not provided by short peptides present in phage display library.
12. 13.
14. 15. 16.
17. 18.
19.
20. 21. 22. 23. 24.
25.
Acknowledgements
26.
This work was supported by the State Committee for Scientific Research (KBN, grant 6 P04A 069 15).
27.
References
29.
1. Wang JC (1996) Annu. Rev. Biochem. 65: 635–692 2. Rossi F, Labourier E, Forne T, Divita G, Derancourt, J, Riou JF, Antoine E, Cathala G, Brunel C & Tazi J (1996) Nature 381: 80–82 3. Kretzschmar M, Meisterernst M & Roeder RG (1993) Proc. Natl. Acad. Sci. USA 90: 11508–11512 4. D’Arpa P, Machlin PS, Ratrie H, Rothfield NF, Cleveland DW & Earnshaw WC (1988) Proc. Natl. Acad. Sci. USA 85: 2543– 2547 5. Haluska P & Rubin EH (1998) Advan. Enzyme Regul. 38: 253–262 6. Labourier E, Rossi F, Gallouzi I, Allemend E, Divita G & Tazi J (1998) Nucleic Acids Res. 26: 2955–2962 7. Bharti AK, Olson MOJ, Kufe DW & Rubin EH (1996) J. Biol. Chem. 271: 1993–1997 8. Pommier Y, Kohlhagen G, Wu C & Simmonds DT (1998) Biochemistry 37: 3818–3823 9. Gobert C, Bracco L, Rossi F, Olivier M, Tazi J, Lavelle F, Larsen AK & Riou JF (1996) Biochemistry 35: 5778–5786 10. Mao Y, Mehl IR & Muller MT (2002) Proc. Natl. Acad. Sci. USA 99:1235–40 11. Haluska P, Saleem A, Rasheed Z, Ahmed F, Su EW, Liu LF & Rubin EH (1999) Nucleic Acids Res. 27: 2538–2544
30.
28.
31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41.
Xu L, Yang L, Hashimoto K, Anderson M, Kolhagen G, Pommier Y & D’Arpa P (2002) BMC Genomic, in press. Straub T, Grue P, Uhse A, Lisby M, Knudsen BR, Tange TO, Westergaard O & Boege F (1998) J. Biol. Chem. 273: 26261– 26264 Turman MA & Douvas A (1993) Biochem. Med. Metabol. Biol. 50: 210–225 Loor G, Zhang SJ, Zhang P, Toomey NL & Lee MYWT (1997) Nucl. Acid Res. 25: 5041–5046 Bauer PI, Chen H, Kenesi E, Kenessey I, Buki KG, Kirsten E, Hakam A, Hwang JI & Kun E (2001) FEBS Lett. 506: 239– 242 Park H & Sternglanz R (1999) Yeast 15: 35–41 Christensen MO, Barthelmes HU, Feineis S, Knudsen BR, Andersen AH, Boege F & Mielke C (2002) J. Biol. Chem. 277: 15661–15665 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Dualan R, Brody T, Keeney S, Nichols AF, Admon A & Linn S (1995) Genomics 29: 62–69 Park SY, Lam W & Cheng Yc YC (2002) Cancer Res 62: 459– 465 Kamiuchi S, Saijo M, Citterio E, de Jager M, Hoeijmakers JH & Tanaka K (2002) Proc. Natl. Acad. Sci. USA 99: 201–206 Cortez D, Wang Y, Qin J & Elledge SJ (1999) Science 286: 1162–1166 Banin S, Moyal L, Shieh S, Taya Y, Anderson CW, Chessa L, Smorodinsky NI, Prives C, Reiss Y, Shiloh Y & Ziv Y (1998) Science 281: 1674–1677 Veals S.A., Schindler C, Leonard D, Fu XY, Aebersold R, Darnell JE & Levy DE (1992) Mol. Cell. Biol. 12: 3315–3324 Meza JE, Brzovic PS, King MC & Klevit RE (1999) J. Biol. Chem. 274: 5659–5665 Giovane A, Pintzas A, Maira SM, Sobieszuk P & Wasyluk B (1994) Genes Dev. 8: 1502–1513 Hennig KA, Li L, Iyer N, McDaniel LD, Reagan MS, Legerski R, Schultz RA, Stefanini M, Lehmann AR, Mayne LV & Friedberg EC (1995) Cell 82: 555–564 Kozak CA, Gatignol A, Graham K, Jeang KT & McBride OW (1995) Genomics 25: 66–72 Rozenblatt–Rosen O, Rozovskaia T, Burakov D, Sedkov Y, Tillib S, Blechman J, Nakamura T, Croce CM, Mazo A & Canaani E (1998) Proc. Natl. Acad. Sci. USA 95: 4152–4157 Wang C, Chua K, Seghezzi W, Lees E, Gozani O & Reed R (1998) Genes Dev. 12: 1409–1414 Allmang C, Petfalski E, Podtelejnikov A, Mann M, Tollervey D & Mitchell P (1999) Genes Dev. 13: 2148–2158 Argos P, Luhrmann R & Philipson L (1986) EMBO J. 5: 3209– 3217 Graveley BR, Hertel KJ & Maniatis T (2001) RNA 7: 806–818 Achsel T, Brahms H, Kastner B, Bachi A, Wilm M & Luhrmann R (1999) EMBO J. 18: 5789–5802 Maul GG, Jimenez S.A., Riggs E & Ziemnicka-Kotula D (1989) Proc. Natl. Acad. Sci. USA 86: 8492–8496 Shiloh Y & Rotman G (1995) Hum. Mol. Genet. 4: 2025–2032 Tassan JP, Jaquenoud M, Leopold P, Schultz SJ & Nigg EA (1995) Proc. Natl. Acad. Sci. USA 92: 8871–8875 Taylor SS, Ha E & McKeon F (1998) J Cell Biol 142: 1–11 Amin AA, Murakami Y & Hurwitz J (1994) J. Biol. Chem. 269: 7735–7743 Neer EJ, Schmidt CJ, Nambudripad R & Smith TF (1994) Nature 371: 297–300