ISSN 10683674, Russian Agricultural Sciences, 2013, Vol. 39, No. 3, pp. 218–221. © Allerton Press, Inc., 2013. Original Russian Text © A.V. Arkhipov, A.G. Solov’yev, V.K. Vishnichenko, 2013, published in Doklady Rossiiskoi Akademii Sel’skokhozyaistvennykh Nauk, 2013, No. 2, pp. 14–17.

PLANT CULTIVATION

Reproduction of Shallot Virus X in Absence of Its Own Active Suppressor Protein of RNA Silencing A. V. Arkhipov, A. G. Solov’yev, and V. K. Vishnichenko Presented by Academician P. N. Kharchenko of Russian Academy of Agricultural Sciences AllRussia Research Institute of Agricultural Biotechnology, Moscow, 127550 email: [email protected] Received April 25, 2012

Abstract—By means of an agrobacterial transient expressing system, it was determined that proteins that are encoded by open reading frames 2, 3, 4, 5, and 6 in the genome of Shallot virus X do not have the function of local RNA silencing suppression. Keywords: RNA interference, Shallot virus X, viral suppressor proteins DOI: 10.3103/S1068367413030051

INTRODUCTION The phenomenon of RNA interference [1] (or RNA silencing) is a complex of epigenetic molecular mechanisms involved in many key biological pro cesses. Particularly, specific RNA degradation during RNA interference is an efficient mechanism of antivi ral protective plant reaction [2]. Replicative (double stranded) forms of viral RNA are inductors of such form of antiviral phytoimmunity; these RNA forms are recognized and split at the first stage of the process by cellular Dicer proteins to produce short (21–23 bp) RNA duplexes (small interfering RNAs) [3]. Existing experimental data indicate that successful virus repro duction in plant hosts depends on the activity of spe cial viral suppressor proteins of RNA silencing that use different strategies for suppression of this form of anti viral phytoimmunity [4]. The aim of the present study was identification of the suppressor proteins of Shallot virus X (SVX), which was discovered by Russian investigators in the early 90’s of the last century [5] and became a proto type of a new genus of phytoviruses (Allexivirus) [6]. SVX genome [7] consists of singlestranded RNA of (+)polarity (8890 nucleotides in length excluding 3' terminal polyadenylate sequence) and contains six open reading frames (ORF) that encode proteins that have (except the p42 (ORF4) protein) a high degree of homology to appropriate proteins of potexviruses and carlaviruses, including the TGBp1 protein, which inhibits system RNA silencing in the process of repro duction of potexviruses and potato carlavirus M, and the CRP protein (3'proximal cysteinerich protein), which inhibits (at least in case of potato M virus) both local and system RNA silencing [8]. However, the results of the present study allow us to conclude that

none of the proteins encoded by ORF 2, 3, 4, 5, and 6 in Shallot virus X genome have a function of local RNA silencing suppressor. METHODS Preparations of SVX and viral RNA were obtained as described previously [5]. Shallot plants (Allium cepa L. var. aggregatum G. Don, selection sample no. 803) that were propagated by vegetative pathway were the source of the virus. Shallot plants of the Red Sun vari ety (Crocus Co., United Kingdom) were used as con trol (not infected by SVX) samples. The level of virus accumulation in plants was estimated by the results of electrophoretic analysis of amplicons obtained by reverse transcription and polymerase chain reaction (RTPCR) using diagnostic primers IAVF + IAVR (that correspond to conservative regions of ORF6) [9]. cDNA synthesis was conducted as follows: at the annealing stage, incubation mixture containing 0.5–2 µg of viral RNA, 2 µL of oligo(dT)18 (40 µM) or “ran dom” (random hexamers, 40 µM) primers, 4 µL of dNTP mixture (each in concentration 2.5 mM, pH 7.0, TrisHCl), and nucleasefree H2O (total volume of the mixture was 16 µL), was heated at 70°C for 5 min, centrifuged, and immediately placed in ice; 2 µL of 10 × RTbuffer, 1 µL (10 units) of ribonuclease inhibitor (RNasin), and 1 µL (50 units) of reverse tran scriptase (MMLV, Moloney, Syntol) were added to the mixture. Reverse transcription (in the volume 20 µL) was conducted at 42°C for 1 h, and the enzyme was inactivated by heating at 90°C for 10 min. Amplification of 3'terminal region of genomic SVX RNA (which includes polyA sequence) was con ducted by the 3'RACEPCR method by means of

218

REPRODUCTION OF SHALLOT VIRUS X

219

Table 1. Structure of primers used for amplification of individual fragments of viral cDNA and their cloning in binary vector “Annealing” positions Amplicone size on genomic SVX RNA (number of base pairs)

Name

Nucleotide sequences of primers

TGBplNcoI TGBplXbaI TGBp2NcoI TGBp2XbaI 42KNcoI 42KXbaI CPNcoI CPXbaI CRPNcoI CRPXbaI

CG(CCATG[G)TG]AAGACTGACCTCCT GC{TCTAGA}TCAGGGGGCGGGGCAAA CG(CCATG[G)TG]AGCTTTGCCCCGCC GC{TCTAGA}TTAATGAGGTTGAGAAC CG(CCATGG)TAATTGTCACGACCTTC GC{TCTAGA}TTAACACAGACCTTCACCCCTA CG(CCATG[G)TG]AACGAAGACGATTTGAAT GC{TCTAGA}TCAGAAAGTTATCATCGGCG CG(CCATG[G)TG]CATCCCCACGATCTAAA GC{TCTAGA}TTATAATTTAAGAGATTTAATTAATAG

5316–5331 6040–6024 6019–6031 6329–6313 6379–6400 7522–7501 7547–7566 8335–8315 8335–8353 8720–8694

725 311 1143 789 385

Note: NcoI restriction site is marked by round brackets; XbaI restriction site is marked by curly brackets; GTG valine triplet is marked by square brackets.

SMARTer RACE cDNA Amplification Kit (Clon tech) according to the manufacture’s protocol, and amplicon nucleotide sequence was determined on a 3130xl sequencer (Applied Biosystems). Amplification of individual fragments of viral cDNA (that correspond to open reading frames 2–6) was per formed by polymerase chain reaction (PCR) under the following conditions: 94°C for 2 min; 30 cycles that include 94°C (30 s), 60°C (30 s), 72°C (30 s); final elongation 72°C 2 min. Amplicons were fractionated in 0.8% agarose gels and sequences as indicated above. Design of primers used in PCR (Table 1) was con ducted by means of the Primer3 (v. 0.4.0) program using information obtained during sequencing of the 3'terminal region of genomic SVX RNA and appro priate data from GenBank (NCBI). For subsequent cloning of separate fragments of viral cDNA in a binary vector, the sequences of NcoI and XbaI restric tion sites (that are absent in sequences of the studied fragments) were included in the structure of primers; in addition, TG dinucleotide was included in the sequence of primers with NcoI restriction site after ini tiation codon and guanylic residue following it; GTG triplet that arising in this way induced inclusion of valine residue (which does not influence the protein activity in vivo) in appropriate polypeptides after Nterminal methionine. Cloning into binary vector. Nucleotide sequences that correspond to one or another reading frame were individually cloned into binary pLH 7000* vector. Amplicons (cut out of the gel) were purified by means of the kit # K0513 (Fermentas). Ligation was con ducted using T4 phage DNA ligase for 2 h at room temperature in the volume 12 µL. Competent cells of tetracyclineresistant E. coli XLBlue strain were transformed by a ligase mixture (Stratagene Gene Cloning System). Clones with insertions that corre spond to estimated length of genes (encoding viral RUSSIAN AGRICULTURAL SCIENCES

Vol. 39

proteins) were selected, and agrobacterial cells were transformed by recombinant plasmids (C58C1 strain). Suppressor activity of the proteins encoded by open reading frames 2–6 were studied using the system of agrobacterial transient expression of reporter protein (green fluorescent protein, GFP) in the N. benthami ana leaves in the presence of specific inductor of RNA interference and known or presumptive viral suppres sor [10, 11]. When studying local silencing, agrobacte ria cell suspension transformed by recombinant plas mids that carry one or another genetic construction (Table 2) were injected in leaves of intact N. benthami ana plants, and the level of the reporter gene expres sion was estimated by the results of fluorometry of experimental plant extracts 5, 6, and 7 days after injec tion (fluorescent LS 55 spectrometer, PerkinElmer). When studying the system silencing, suspension of agrobacterial cells was injected in leaves of the bottom level of transgenic N. benthamiana plants (line 16s), and the intensity of GFP fluorescence in leaves of the top level was estimated after 14–16 days by fluorometry. RESULTS AND DISCUSSION Use of diagnostic IAVF and IAVR primers in a polymerase chain reaction allows us to quite strictly estimate the level of SVX accumulation on Shallot plants at one or another stage of infection. Maximal virus concentration in plants was reached 2–3 weeks after transplanting of bulbs, and viral preparations iso lated from such material were the source of intact viral RNA. Computer analysis of the nucleotide sequence of the 3'terminal fragment of genomic SVX RNA obtained in the current study (data not shown) and comparison of this sequence with information stored in GenBank (NCBI) allowed us to conclude that the SVX genome has not changed significantly as a result of the continuous period of vegetative reproduction of infected Shallot plants. On this basis, information that

No. 3

2013

220

ARKHIPOV et al.

Table 2. Designations and principal schemes of genetic constructions used in the process of agrobacterial transient expres sion of reporter GFP gene in N. benthamiana leaves: 35S promoter, coding insertion, 3'terminal untranslated region of , , , and , respectively RNAβ of barley stripe mosaic virus, and 35Sterminator are designated by EV

Vector (pLH 7000*) without insertion (Empty Vector)

VGFP

Vector carrying an insertion that encodes a soluble form of green flu orescent protein (GFP)

GFP

VdsGF GF

Vector carrying a construction that plays a role of inductor of RNA interference: 5'proximal region (342 nucl.) of modified GFP gene (GFPC3); 3'terminal untranslated region of RNAβ of barley stripe mosaic virus, and GFPC3 in reverse orientation Vector carrying an insertion that encodes p19 suppressor protein of tombusviruses

FG

Vp19 p19

Vector carrying an insertion that encodes γb suppressor protein of gordeiviruses VShVXORF2, VShVXORF3, VShVXORF4, Vectors with insertions of SVX open reading frames 2–6 that encode VShVXORF5, VShVXORF6 proteins with supposed suppressor activity

Vγb

we previously obtained [5] was used during the con struction of primers for amplification of individual fragments of viral cDNA and their cloning in binary vector. Amplicons (synthesized using these primers and corresponding to different regions of SVX genomic RNA) were fractionated by electrophoresis in agarose gel (Fig. 1) and sequenced. The obtained sequences contained flanking sites of NcoI and XbaI restriction, initiating codon, and appropriate open reading frames, that is, all elements required for clon ing in binary vector and subsequent use in the system of agrobacterial transient expression of the studied proteins.

The results of fluorometry of the N. benthamiana plant leave extracts 5, 6, and 7 days after injection of the cells of agrobacteria that carry one or another genetic constructions are represented in Fig. 2. As fol lows from these data, restoration of the level of GFP expression (decreased as a result of the effect of VdsGFP construction that plays a role of RNA inter ference inductor) was observed only in the presence of the suppressor protein of tombusviruses (Vp19 con struction); at the same time, none of the tested SVX proteins had such activity. In addition, the results of preliminary experiments indicate that, as opposed to its potexand carlavirus homologues, the TGBp1 pro

(a)

1

(b)

2

1000

1000

500

500

1

2

3

4

5

Fig. 1. Analysis of amplicons that correspond to different regions of the genomic SVX RNA by electrophoresis in agarose gel. (a): Track 1—amplicon that corresponds to the 3'terminal region of the genomic SVX RNA, including sequence that encodes p15 protein; track 2—DNA markers 100 bp + 1.5 Kb; (b): Amplicons that correspond to regions of the SVX genome that encode TGBp1 (track 1), TGBp2 (track 2), p42 (track 3), and capsid (p37) protein (track 4); Track 5—DNA markers 100 bp + 1.5 Kb; position of markers with the length 500 and 1000 bp is demonstrated by a numeral on the right. RUSSIAN AGRICULTURAL SCIENCES

Vol. 39

No. 3

2013

REPRODUCTION OF SHALLOT VIRUS X

221

1000 5 dpi 6 dpi 7 dpi

800 600 400 200 0 mock inoculation

VGPF + VdsGF

VGPF + VdsGF + Vp19

VGPF + VdsGF + VORF 2

VGPF + VdsGF + VORF 3

VGPF + VdsGF + VORF 4

VGPF + VdsGF + VORF 5

VGPF + VdsGF + VORF 6

Fig. 2. Fluorometry of N. benthamiana leave extracts 5, 6, and 7 days after injection of agrobacterial cells transformed by recom binant plasmids that carry one or another genetic construction.

tein of SVX (ORF2) does not inhibit system RNA silencing (data not shown). Thus, the results of the study allow us to conclude that SVX is reproduced in Shallot plants in the absence of its own activity of the suppressor protein of RNA silencing. It is not excluded that RNA silencing sup pression (required for successful SVX reproduction in the studied system) can be a result of complementa tion interaction of homologous suppressor proteins (TGBp1 and (or) CRP) of two components of the viral complex persistent in different species of the Allium genus (allexivirus SVX and latent Shallot carlavirus) [12]. This hypothesis is currently being checked in the laboratory of the institute. REFERENCES 1. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C., Potent and specific genetic interference by doublestranded RNA in Cae norhabditis elegans, Nature, 1998, vol. 391, pp. 806– 811. 2. Csorba, T., Pantaleo, V., and Burgybn, J., RNA silenc ing: an antiviral mechanism, Adv. Virus Res., 2009, vol. 75, pp. 35–71. 3. Deleris, A., GallegoBartolome, J., Bao, J., Kass chau, K.D., Carrington, J.C., and Voinnet, O., Hierar chical action and inhibition of plant Dicerlike proteins in antiviral defense, Science, 2006, vol. 313, pp. 68–71. 4. Qu, F., Plant viruses versus RNAi: simple pathogens reveal complex insights on plant antimicrobial defense, Wiley Interdiscip. Rev.: RNA, 2010, vol. 1, pp. 22–33.

RUSSIAN AGRICULTURAL SCIENCES

Vol. 39

5. Vishnichenko, V.K., Kowreva, T.N., and Zavriev, S.K., A new filamentous virus in shallot, Plant Pathol., 1993., vol. 42, pp. 121–126. 6. Allexivirus in ICTVdBThe Universal Virus Database, v. 4, 2006. 7. Kanyuka, K.V., Vishnichenko, V.K., Levay, K.K, Kon drikov, D.Yu., Ryabov, E.V., and Zavriev, S.K., Nucle otide sequence of shallot virus X RNA reveals a 5'prox imal cistron closely related to those of potexviruses and a unique arrangement of the 3'proximal cistrons, J. Gen. Virol., 1992, vol. 73, pp. 2553–2560. 8. Senshu, H., Yamaji, Y., Minato, N., Shiraishi, Т., Maejima, K., Hashimoto, M., Miura, C., Neriya Y., and Namba, S., A dual strategy for the suppression of host antiviral silencing: two distinct suppressors for viral replication and viral movement encoded by potato virus M, J. Virol., 2011, vol. 85, pp. 10269–10278. 9. Majumder, S., Arya, M., Pant, R.E., and Baranwal, V.K., Shallot virus X in Indian shallot, a new virus report for India, New Dis. Rep., 2007, vol. 15, p. 52. 10. Johansen, L.K. and Carrington, J.C., Silencing on the spotinduction and suppression of RNA silencing in the Agrobacleriummediated transient expression sys tem, Plant Physiol., 2001, vol. 126, pp. 930–938. 11. Yelina, N.E., Erokhina, T.N., Lukhovitskaya, N.I., Minina, E.A., Schepetilnikov, M.K., Lesemann, D.E., Schiemann, J., Solovyev, A.G., and Morozov, S.Y., Localization of Poa semilatent virus cysteinerich pro tein in peroxisome is dispensable for its ability to sup press RNA silencing, J. Gen Virol., 2005, vol. 86, pp. 479–489. 12. Bos, L., Viruses and virus diseases of Allium species, Acta Hortic., 1983, vol. 127, pp. 11–29.

No. 3

Translated by A. Barkhash

2013