Breast Cancer Res Treat (2011) 126:555–563 DOI 10.1007/s10549-010-0955-3

PRECLINICAL STUDY

RACK1 promotes breast carcinoma migration/metastasis via activation of the RhoA/Rho kinase pathway Xi-Xi Cao • Jing-Da Xu • Jia-Wen Xu • Xiao-Li Liu • Yuan-Yuan Cheng • Qing-Quan Li Zu-De Xu • Xiu-Ping Liu

•

Received: 29 March 2010 / Accepted: 13 May 2010 / Published online: 25 May 2010 Ó Springer Science+Business Media, LLC. 2010

Abstract We aimed to gain a mechanistic understanding of the role of RACK1 in breast carcinoma migration/ metastasis. Migration assays were conducted in breast carcinoma cell lines. siRNA targeting RACK1 as well as the Rho kinase inhibitor were also applied. Immunoprecipitation and immunofluorescence were used to study the RACK1/RhoA interaction. GTP-Rho pull-down assays were performed to assess the activation of RhoA. We also conducted immunohistochemistry in 160 breast carcinoma samples. Experiments in vitro showed that RACK1 promotes migration via interaction with RhoA and activation of the RhoA/Rho kinase pathway. Immunohistochemistry in 160 samples revealed that RACK1 is strongly correlated with accepted tumor spread indicators and RhoA (all P \ 0.05). Kaplan–Meier survival analysis indicated a correlation between higher RACK1 expression and shorter survival times (P \ 0.001). RACK1 is a prognostic factor that promotes breast carcinoma migration/metastasis by interacting with RhoA and activating the RhoA/Rho kinase pathway. Keywords RACK1  Breast carcinoma  Metastasis  Migration  RhoA/Rho kinase

Electronic supplementary material The online version of this article (doi:10.1007/s10549-010-0955-3) contains supplementary material, which is available to authorized users. X.-X. Cao  J.-D. Xu  J.-W. Xu  X.-L. Liu  Y.-Y. Cheng  Q.-Q. Li  Z.-D. Xu  X.-P. Liu (&) Department of Pathology, Shanghai Medical College, Fudan University, 138 Yi Xue Yuan Road, Shanghai 200032, China e-mail: [email protected]

Introduction Breast carcinoma affects 12% of women, 40% of who eventually die from metastatic disease [1]. Breast cancer metastasis results from the accumulation of multiple genetic alterations in mammary epithelial cells, and many of the complex molecular pathways underlying this pathological process remain to be characterized [2]. In our previous studies, we started by screening a human mammary cDNA library in order to investigate new mechanisms involved in breast carcinoma growth and progression. From these studies, the receptor for activated C-kinase 1 (RACK1) emerged as a target for future experiments, and its potential as a diagnostic and prognostic factor for breast carcinoma was initially observed [3, 4]. RACK1 is a scaffold protein with a propeller-like structure of seven WD-40 repeats. It was originally identified on the basis of its ability to bind the activated form of protein kinase C, stabilize this protein and facilitate its trafficking within the cell [5]. Previous studies have shown that the WD-40 repeats play a role in complex protein–protein interactions between signaling molecules such as integrins, phosphodiesterase 4D5, and Src tyrosine kinase, as well as protein kinase C (PKC) [6]. As a result, it may be involved in diverse cellular processes, including signal transduction, immune response, as well as cell growth, migration and differentiation [7, 8]. Accumulating evidence suggests that activation of small GTPase proteins such as RhoA and Rho kinase, a downstream effector, are critical for tumor invasion and/or metastasis [9–11]. RhoA stimulates the assembly of contractile actomyosin filaments and associated focal adhesion complexes [12]. However, the role of RhoA/Rho kinase activation in breast carcinoma is still unclear.

123

556

In this article, we demonstrate that RACK1 promotes breast carcinoma migration/metastasis by interacting with RhoA and activating the RhoA/Rho kinase pathway in both breast carcinoma cell lines and 160 breast cancer patient samples. RACK1 is a prognostically important factor that promotes breast carcinoma migration/metastasis in vitro and in vivo.

Materials and methods Cell culture and transfection Four human mammary carcinoma cell lines with different invasion abilities were used in our experiment: MCF7 and T-47D with low invasion abilities as well as MDA-MB-231 and the MDR (multidrug resistant) counterpart of MCF7, MCF7/ADR [13], with relatively higher invasion abilities [3]. All cells were grown in the recommended medium supplemented with 10% fetal bovine serum (Gibco, Grand Island, USA), 2 mmol/l glutamine, 50 units/ml penicillin, and 50 units/ml streptomycin; cells were maintained in a 37°C atmosphere. Transient transfection of cells was achieved with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, USA). Cell lines stably expressing RACK1 were generated by transfection and selection with G418 antibiotic (Gibco) as described previously [3]. We used siRNAs targeting the human RACK1 (GNB2L1) gene sequence, 50 CAGATTGTCTCTGGATCTCGA 30 , which were purchased from QIAGEN (Duesseldorf, Germany). Immunoprecipitation and immunoblotting Forty-eight hours after transfection, cells were collected, washed with phosphate-buffered saline (PBS) (pH 7.4), and lysed in modified RIPA buffer (50 mM Tris (pH 7.8), 150 mM NaCl, 5 mM EDTA, 15 mM MgCl2, 1% NP-40, 0.5% sodium deoxycholate, 1 mM DTT, and 20 mM N-ethylmaleimide) supplemented with 1 tablet/50 ml of Complete Protease Inhibitor Cocktail (Roche Molecular Biochemical, Indianapolis, USA). Lysates were cleared by centrifugation (10,0009g for 15 min at 4°C) and incubated on ice for 2 h with 1–2 lg of the relevant antibody (Ab) (anti-GFP, Roche; anti-HA, anti-RhoA, Sigma–Aldrich, St. Louis, USA; anti-RACK1, BD Biosciences, San Jose, USA). Next, 20 ll of slurry protein A/G PLUS-Agarose immunoprecipitation reagent (Santa Cruz Biotechnology, Santa Cruz, USA) was added to each lysate, and the mixtures were incubated with rotation for at least 2 h at 4°C. The beads were retrieved by centrifugation and washed (by vortex and short spin) three times with RIPA buffer and once with PBS. Proteins bound to the beads were eluted by

123

Breast Cancer Res Treat (2011) 126:555–563

boiling in 29 electrophoresis sample buffer and separated by SDS-PAGE as described previously [3]. Immunofluorescence analysis Cells seeded on 6-well chamber slides were fixed in 4% paraformaldehyde, permeabilized in 0.1% Triton X-100 and blocked in 5% BSA. Protein levels were detected using the indicated primary antibodies, followed by incubation for 45 min with Cy3-conjugated or FITC-conjugated secondary antibodies (Amersham Biosciences). The coverslips were washed, mounted in phosphate-buffered saline containing 50% glycerol, and viewed on a Leica laser scanning confocal microscope (or the automated microscope Leica DMRXA2) equipped with a Photometrics Cool SnapES N&B camera driven by MetaMorph software (Universal Imaging Corporation, Downingtown, USA). Migration analysis The scratch test and modified Boyden dual chamber assay were performed as previously described [3]. The Rho kinase inhibitor, Y-27632, was purchased from Calbiochem (Darmstadt, Germany). Determination of the level of GTP-bound RhoA GTP-Rho pull-down assays were performed according to the supplier’s protocol (Upstate Biotechnology, Lake Placid, NY). Briefly, cells treated with the indicated chemicals were washed twice with ice-cold TBS, scraped off the plates in lysis/wash buffer (50 mM Tris–HCl at pH 7.4, 2 mM MgCl2, 1% lgepa, 10% glycerol, 100 mM NaCl, supplemented with 1 mM dithiothreitol, 10 lg/ml leupeptin, and 10 lg/ml aprotinin) on ice. The lysates were incubated with the Rhotekin RBD-agarose slurry at 4°C for 45 min with gentle agitation and then washed three times with wash buffer. The bound proteins were boiled and eluted with 29 sample buffer and detected by SDS-PAGE as described above. Patient characteristics and immunohistochemistry Paraffin-embedded tissue samples from 160 mammary carcinomas were prepared as previously described [4]. All patients with primary mammary carcinoma underwent curative surgery at the Huashan Hospital of Fudan University between January 1999 and December 2002. None of the patients received chemotherapy or radiation therapy before surgery, and after successful radical mastectomy, all 160 patients only received four cycles of cyclophosphamide, methotrexate, and 5-fluorouracil (CMF). All patients were followed after surgery (until December 31, 2009), and

Breast Cancer Res Treat (2011) 126:555–563

detailed and complete clinicopathological data were collected on each patient. The follow-up time ranged from 1.5 months to 130 months, with a median time of 81 months. At the end of the follow-up period, 132 patients were still alive and 28 had died of the disease. Analysis of RACK1 protein expression (including positive and negative control samples) was carried out and scored as previously described using a RACK1 mouse monoclonal antibody (Lifespan, Seattle, USA) [4]. Briefly, total RACK1 staining was scored based on the intensity and percentage of cells with RACK1 cytoplasmic staining on the following scale: score 0, negative/weak staining for all tumor cells or moderate staining less than 30%; score 1, moderate staining in more than 30% but less than 70% of tumor cells or strong staining within 30% of tumor cells; score 2, moderate staining in more than 70%, or strong staining in more than 30% of all tumor cells. RhoA staining using the rabbit polyclonal antibody (Santa Cruz Biotechnology) was scored as previously described [9]. The clinical studies included the essential elements of ‘‘Reporting recommendations for tumor marker prognostic studies (REMARK)’’ [14]. Statistical evaluation All data were representative of at least three independent experiments with similar results. The results are expressed as the mean (±1 SEM) from multiple experiments. A student’s t test was used to determine significant differences (twotailed, P \ 0.05). Pearson’s correlation coefficients were used to determine whether two prognosis-related factors were correlated to each other over all cases. Kaplan–Meier survival analysis was used to estimate the prognostic relevance of RACK1, and the disease-free survival difference between groups was assessed by the log-rank test. The COX proportional hazards model was used for multivariate analysis of survival. The software SPSS 15.0 for Windows was used for statistical analyses, and P \ 0.05 was considered statistically significant.

Results Up-regulation of RACK1 promotes migration of breast carcinoma cells Cell lines stably expressing RACK1 were generated as described previously [3]. The effects of RACK1 on breast carcinoma cell migration (MCF7, clone M-R4; T-47D, clone T-R2) were assessed by scratch tests (Fig. 1a) and transwell assays (Fig. 1b). As shown in Fig. 1a, b, upregulation of RACK1 in both MCF7 and T-47D induced a significant increase in the cells’ migration capacity.

557

In order to verify the effects of RACK1, we introduced siRNAs specifically targeting RACK1 into breast carcinoma cells (MCF7/ADR and MDA-MB-231) and repeated the migration assay (Fig. 1b, c). These data confirmed that RACK1 promotes migration in breast carcinoma cells. RACK1 promotes migration of breast carcinoma cells through interaction with RhoA In order to explore possible mechanism(s) underlying RACK1 regulation, we pretreated breast carcinoma cells (MCF7, clone M-R4; T-47D, clone T-R2) for 1 h with the Rho kinase inhibitor Y-27632 (10 lM) and plated them. Both the scratch test and migration test (using the transwell technique) were performed. Compared to the solvent control, inhibition of Rho kinase dramatically reduced the increase in cell migration induced by RACK1 (Fig. 1d, e). Accordingly, we investigated interactions between RACK1 and RhoA using MCF7 and MCF7/ADR via immunoprecipitation (Fig. 2a) and immunofluorescence analyses (Fig. 2b). Co-immunoprecipitation was performed in both MCF7 cells stably expressing RACK1 and MCF7/ ADR cells transiently transfected with pEGFP-N3RACK1. As shown in Fig. 2a, RACK1 was co-immunoprecipitated with RhoA. This interaction was further confirmed using MCF7 and MCF7/ADR cells transiently transfected with pcDNA3.0-HA-RhoA (Fig. 2b). Furthermore, immunofluorescence analysis revealed that RhoA co-localized with RACK1 mainly in the cytoplasm of MCF7 and MCF7/ADR cells, especially in the cytoplasm of MCF7 cells stably transfected with pEGFPRACK1 (Fig. 2c).

Up-regulation of RACK1 promotes the RhoA activation Rearrangement of the actin cytoskeleton, which precedes the formation of pseudopods, is regulated by Rho family small G proteins including RhoA [15]. We tested the possibility that RACK1 activates this small G protein in breast carcinoma cells. First, we examined the involvement of RhoA in the cell line stably expressing RACK1. The level of active, GTP-bound RhoA significantly increased in MCF7-RACK1 and T-47D, whereas total RhoA remained unchanged (Fig. 3a). Next, we found that the level of GTPbound RhoA was significantly decreased when siRNA targeting RACK1 was introduced in MCF7/ADR and MDA-MB-231 cell lines as well as when Y-27632 was introduced in MCF7 and T-47D cells (Fig. 3b). These results show that RACK1 enhanced the activation of RhoA, which is a mechanism underlying the promotion of cell migration by RACK1.

123

558

Breast Cancer Res Treat (2011) 126:555–563

Fig. 1 Up-regulation of RACK1 promotes migration in breast carcinoma cells. Scratch tests and migration assay (using a modified Boyden chamber) showing increased migration in RACK1 upregulated breast cancer cell lines (a and b) and verification using siRNA

specifically targeted to RACK1 (b and c). The increase in migration caused by RACK1 in breast carcinoma cells (MCF7, clone M-R4; T-47D, clone T-R2) was significantly inhibited after administering the Rho kinase inhibitor, Y-27632 (10 lM) (d and e)

RACK1 significantly correlates with indicators of clinical spread and RhoA in 160 breast carcinoma patients

Discussion

In order to verify the in vitro results mentioned above, we performed immunohistochemical staining for RACK1 and RhoA in 160 breast carcinoma samples. Table 1 shows the correlation of RACK1 and patients’ major clinicopathological characteristics. Both the RACK1 and RhoA were readily detected in the cytoplasm (Supplementary Fig. S1). Moreover, we observed a significant correlation between RACK1 expression and tumor size (P = 0.046), lymph node metastasis (P = 0.027) (Fig. 4a, Table 1), and percentage of carcinoma in situ (the percentage of in situ components in all carcinoma tissues per patient; r = –0.691, P \ 0.001; Fig. 4a, b), which are commonly used indicators closely related to metastasis in breast carcinoma. More intriguingly, RACK1 significantly correlated with RhoA (r = 0.814, P \ 0.001; Table 2). Further, a Kaplan– Meier survival analysis of 160 carcinoma cases revealed a correlation between higher RACK1 expression levels and shorter survival times (P \ 0.001, Fig. 4c).

123

In this study, a series of experiments (in vitro and in vivo) were designed to evaluate the role of RACK1 in breast carcinoma migration/metastasis. First, we found that upregulation of RACK1 significantly promoted breast carcinoma migration/metastasis by interacting with RhoA and activating the RhoA/Rho kinase pathway. In our previous studies, we screened a human mammary cDNA library (using the PI3K p110a kinase domain as bait) to identify novel PI3K p110a-interacting proteins. From the candidate genes, we identified RACK1 as a putative target in human breast carcinoma cells. Further experimentation indicated that RACK1 promotes breast carcinoma proliferation in vitro and in vivo. In addition, these studies suggested the potential involvement of RACK1 in breast carcinoma invasion/metastasis [3, 4]. In this study, we performed migration assays including the scratch test and modified Boyden dual chamber assay in four breast carcinoma cell lines with different migratory properties accompanied with different expression levels of RACK1 [3]. In order to test the results obtained from

Breast Cancer Res Treat (2011) 126:555–563 Fig. 2 RACK1 interacts with RhoA. a MCF7 and MCF7/ ADR cells were transfected with pEGFP-N3-RACK1 or pcDNA3.0-HA-RhoA. Cell lysates were subjected to immunoprecipitation (IP) with anti-GFP followed by immunoblotting (IB) with antiRhoA or IP with anti-HA followed by IB with antiRACK1. b Co-localization of RACK1 and RhoA in MCF7RACK1 (clone M-R4) and MCF7/ADR cells. The panels show representative fields. Co-localization is shown by yellow cellular staining and occurred mainly in the cytoplasm

559 MCF7

A

IP:

IgG

MCF7/ADR

input RACK1 input RACK1

IB: RhoA IB: GFP MCF7

B IP:

IgG

input

MCF7/ADR RhoA

IgG

input

RhoA

IB: RACK1 IB: HA

MCF7/ADR

MCF7

C RhoA

RACK1

Merged

RhoA

RACK1

Merged

Fig. 3 Elevated RACK1 promotes the activation of RhoA. GTP-Rho pull-down assays showing the activation of RhoA in RACK1upregulated breast cancer cells and verification using RACK1 siRNA.

The activation of RhoA caused by RACK1 in stably transfected breast carcinoma cells (clone M-R4 and T-R2) could be significantly inhibited after the administration of the Rho kinase inhibitor, Y-27632

RACK1 upregulation, we also applied siRNA targeting RACK1 in MCF7/ADR and MDA-MB-231 and the results were the same as we have observed in MCF7 [3].

Immunohistochemistry and statistical analyses of 160 breast carcinoma samples showed that increased RACK1 expression correlated with tumor size, lymph node

123

560

Breast Cancer Res Treat (2011) 126:555–563

Table 1 Correlations of RACK1 and major clinical pathologic factors (n = 160) Factors Age (year) Mean (SD) Menopause No Yes Ta T1 T2 T3 Nb N0 N1 N2 N3 Carcinoma in situ %c G1 (0–2%) G2 (3–7%) G3 (8–10%) Pathological classification Invasive ductal Lobular Medullary Mucinous Histological grade Low (I) Intermediate (II) High (III) Clinical stage IA IIB IIIA IIIC IV Ki67 Negative (?) Positive (?? to ????) ER Negative (-) Positive (? to ???) PR Negative (-) Positive (? to ???) HER-2 Negative (-) Positive (? to ???) RhoA Negative (-) Positive (? to ???) a

Total n 56.34 (10.693)

P valued 0.561 0.437

94 66 0.046 90 51 19 0.027 3 111 28 18 \0.001 (2.507 9 10-7) 31 50 79 0.132 123 22 7 8 0.004 88 55 17 0.007 53 58 30 15 4 \0.001 (4.814 9 10-9) 38 122 0.008 67 93 \0.001 (1.752 9 10-6) 84 76 0.046 60 100 \0.001 (6.280 9 10-11) 51 109

T tumor size N lymph node metastasis c Carcinoma in situ % the percentage of in situ components in all carcinoma tissues d P \ 0.05 was considered statistically significant b

123

metastasis, and percentage of carcinoma in situ, all of which are clinical indicators for tumor spread. More intriguingly, RACK1 significantly correlated with RhoA. Furthermore, Kaplan–Meier survival analysis indicated a significant correlation between higher RACK1 expression levels and shorter overall survival times. Our in vitro and in vivo experiments demonstrated that RACK1 promotes breast carcinoma migration/metastasis. In recent years, a number of studies have focused on the role of RACK1 in cell migration control mechanisms; however, these studies have been limited to different mammalian cell lines [6]. Cells that over-express RACK1 demonstrate enhanced spreading, an increased number of actin stress fibers, focal contacts, and enhanced tyrosine phosphorylation of both focal adhesion kinase and paxillin [8, 16]. Conversely, reduction of RACK1 expression in NIH3T3 cells by antisense depletion blocked cell spreading [8]. Another break-through of our present research is that genuine RACK1/RhoA interaction was demonstrated for the first time using immunoprecipitation and immunofluorescence in MCF7 and MCF7/ADR cells. The Rho kinase inhibitor further demonstrated the involvement of the RhoA/Rho kinase pathway. Multiple reports have reported that versatile interactions exist between RACK1 and central signaling molecules including integrins, phosphodiesterase 4D5, Src tyrosine kinase, and protein kinase C (PKC) [5, 6, 17]. The basis of these complex protein– protein interactions lie in the WD-40 repeats. RACK1 is a 36 kDa cytosolic protein with a propeller-like structure consisting of seven WD-40 repeats that are compatible with the consensus WD motif used to identify members of the WD repeat family. Its amino acid sequence is 100% identical in humans, rats, chickens [18], mice [19], and cows [20], and RACK1 is ubiquitously expressed in a wide range of tissues, including the brain, liver, and spleen [21]. This spatial–temporal conservation has prompted a suggestion that RACK1 is important in a variety of biological functions including signal transduction, immune response, as well as cell growth, migration, and differentiation [6]. We also performed GTP-Rho pull-down assays to assess the role of RhoA activation in the promotion of migration induced by RACK1. We found the level of active form of RhoA significantly increased in MCF7-RACK1 and T-47D-RACK1 compared with parental cells, while the total amount of RhoA remained unchanged. Further, the RhoA activation could be significantly decreased by the introduction of siRNA targeting RACK1 into MCF7/ADR and MDA-MB-231 cells. In line with our findings, a causal effect of Rho GTPases in breast cancer has been shown using a model of breast carcinoma in rodents [22]. Other studies have indirectly shown an important role of RhoA in breast carcinogenesis [23, 24]. It is known that uncontrolled cell migration is necessary for tumor invasion and

Breast Cancer Res Treat (2011) 126:555–563

561

Fig. 4 The correlations of RACK1 and clinicopathological factors. RACK1 correlates with tumor size, lymph node metastasis (a), percentage of carcinoma in situ (a and b) (all P \ 0.05). c Kaplan–

Meier analysis of disease-specific survival in 160 breast carcinoma patients stratified by RACK1 expression level (P \ 0.001)

Table 2 The significant correlation of RACK1 expression with RhoA

(active) form, RhoA GTPases are localized to membranes and are able to interact with effector molecules, thereby initiating downstream responses. RhoA regulates the organization of the actin cytoskeleton of cells and is essential for the regulation of cell shape, polarity, motility, and adhesion [29]. The cytoskeletal changes elicited by RhoA, including neurite retraction, stress fiber formation, and focal adhesion assembly are mediated mostly by Rho kinases [30]. Studying the role of Rho kinases in tumorigenesis has been greatly facilitated by several compounds that specifically target their activity [31], the prototype of which is Y-27632. This compound inhibits focus formation and growth in soft agar of Rho- and Ras-transformants [32]. There is an extensive body of evidence indicating that Rho kinase activity is directly implicated in the invasive behavior of tumor cells derived from different human tumors. For instance, inhibition of Rho kinase via Y-27632 or expression of a dominant negative mutant abrogates invasion of rat MM1 hepatoma-induced tumors in vivo [33]. Similarly, in our experiment, human breast carcinoma cells stably transfected with RACK1 treated with Y-27632 show significant inhibition of in vitro tumor migration, suggesting that the RhoA/Rho kinase pathway might be one of the mechanisms underlying breast carcinoma migration/metastasis induced by RACK1.

RACK1

RhoA (-)

(?)

(??)

(???)

0

48

13

5

0

1

3

25

26

0

2

0

7

12

21

a

r

0.814

P value

\0.001 (6.280 9 10-11)

a

r Pearson’s correlation coefficient

metastasis, which requires actin polymerization, depolymerization, changes in the integrin-mediated membrane attachment to the substrate, and modifications in cell shape. These changes are produced, at least in part, by rearrangements of the actin cytoskeleton, which is also a crucial step in tumor progression [25]. Several members of the Ras homologous (Rho) family of small GTPases (namely Rho, Rac, and Cdc42) act as key regulators of the actin cytoskeleton [26, 27]. RhoA, a regulator of cell migration [28], is one of the most important members of Rho GTPases. Like all members of the small GTPases superfamily, this protein cycles between an inactive GDP-bound form, and an active GTP-bound state. In their GTP-bound

123

562

Moreover, it has been reported that RhoA-mediated focal adhesion kinase (FAK) phosphorylation can activate PI3K and AKT [34]. In addition, RhoA/Rho kinase pathway may mediate epithelial–mesenchymal transition (EMT) induced by TGF-b1 in rat peritoneal mesothelial cells [35]. In our previous findings, we identified RACK1 as a binding partner of both PI3K p110a [3] and p-AKT (unpublished results). RACK1 up-regulation led to PI3K/ AKT pathway activation [3] and EMT in breast cancer cells, accompanied by enhanced invasive phenotype (unpublished results). These results supported a hypothesis that RACK1 exposes the propeller architecture with seven blades as a platform for interactions with versatile kinases and crosstalk between pathways such as the PI3K/AKT and RhoA/Rho kinase pathways. Applying this platform, RACK1 works as a cog in cell which can recruit specific proteins to the appropriate location for a particular function. In summary, this study is the first to present evidence that RACK1 promotes breast carcinoma migration/metastasis through interaction with RhoA and activation of the RhoA/Rho kinase pathway. In the near future, RACK1 could be included in a broadened panel of biomarkers used for more accurate diagnosis and prognosis in breast cancer patients. Acknowledgments The authors acknowledge grant supports received from National Nature Science Foundation of China (No. 30870972 and No. 30872971).

References 1. McPherson K, Steel CM, Dixon JM (1994) ABC of breast diseases. Breast cancer epidemiology, risk factors and genetics. BMJ 309:1003–1006 2. Tjan-Heijnen VCG, Bult P, de Widt-Levert LM, Ruers TJ, Beex LVAM (2001) Micro-metastases in axillary lymph nodes: an increasing classification and treatment dilemma in breast cancer due to the introduction of the sentinel lymph node procedure. Breast Cancer Res Treat 70:81–88 3. Cao XX, Xu JD, Xu JW, Liu XL, Cheng YY, Wang WJ, Li QQ, Chen Q, Xu ZD, Liu XP (2009) RACK1 promotes breast carcinoma proliferation and invasion/metastasis in vitro and in vivo. Breast Cancer Res Treat. doi:10.1007/s10549-009-0657-x (Epub ahead of print) 4. Cao XX, Xu JD, Liu XL, Xu JW, Wang WJ, Li QQ, Chen Q, Xu ZD, Liu XP (2009) RACK1: a superior independent predictor for poor clinical outcome in breast cancer. Int J Cancer. doi: 10.1002/ijc.25120 (Epub ahead of print) 5. Ron D, Chen CH, Caldwell J, Jamieson L, Orr E, Mochly-Rosen D (1994) Cloning of an intracellular receptor for protein kinase C: a homolog of the beta subunit of G proteins. Proc Natl Acad Sci USA 91:839–843 6. McCahill A, Warwicker J, Bolger GB, Houslay MD, Yarwood SJ (2002) The RACK1 scaffold protein: a dynamic cog in cell response mechanisms. Mol Pharmacol 62:1261–1273

123

Breast Cancer Res Treat (2011) 126:555–563 7. Kubota T, Yokosawa N, Yokota S, Fujii N (2002) Association of mumps virus V protein with RACK1 results in dissociation of STAT-1 from the alpha interferon receptor complex. J Virol 76:12676–12682 8. Hermanto U, Zong CS, Li W, Wang LH (2002) RACK1, an insulin-like growth factor I (IGF-I) receptor-interacting protein, modulates IGF-I-dependent integrin signaling and promotes cell spreading and contact with extracellular matrix. Mol Cell Biol 22:2345–2365 9. Wu Di, Asiedu Michael, Wei Qize (2009) MyoGEF regulates the invasion activity of MDA-MB-231 breast cancer cells through activation of RhoA and RhoC. Oncogene 28:2219– 2230 10. Pille´ JY, Denoyelle C, Varet J, Bertrand JR, Soria J, Opolon P, Lu H, Pritchard LL, Vannier JP, Malvy C, Soria C, Li H (2005) AntiRhoA and anti-RhoC siRNAs inhibit the proliferation and invasiveness of MDA-MB-231 breast cancer cells in vitro and in vivo. Mol Ther 11:267–274 11. Simpson KJ, Dugan AS, Mercurio AM (2004) Functional analysis of the contribution of RhoA and RhoC GTPases to invasive breast carcinoma. Cancer Res 64:8694–8701 12. van Golen KL, Wu ZF, Qiao XT, Bao LW, Merajver SD (2000) RhoC GTPase, a novel transforming oncogene for human mammary epithelial cells that partially recapitulates the inflammatory breast cancer phenotype. Cancer Res 60:5832–5838 13. Davies R, Budworth J, Riley J, Snowden R, Gescher A, Gant TW (1996) Regulation of P-glycoprotein 1 and 2 gene expression and protein activity in two MCF7/ADR cell line subclones. Br J Cancer 73:307–315 14. McShane LM, Altman DG, Sauerbrei W, Taube SE, Gion M, Clark GM (2006) Reporting recommendations for tumor marker prognostic studies (REMARK). Breast Cancer Res Treat 100:229–235 15. Boettner B, Van Aelst L (2002) The role of Rho GTPases in disease development. Gene 286:155–174 16. Buensuceso CS, Woodside D, Huff JL, Plopper GE, O’Toole TE (2001) The WD protein Rack1 mediates protein kinase C and integrin-dependent cell migration. J Cell Sci 114:1691–1698 17. Schechtman D, Mochly-Rosen D (2001) Adaptor proteins in protein kinase C-mediated signal transduction. Oncogene 20:6339–6347 18. Sklan EH, Podoly E, Soreq H (2006) RACK1 has the nerve to act: structure meets function in the nervous system. Prog Neurobiol 78:117–134 19. Imai Y, Suzuki Y, Tohyama M, Wanaka A, Takagi T (1994) Cloning and expression of a neural differentiation-associated gene, p205, in the embryonal carcinoma cell line P19 and in the developing mouse. Brain Res Mol Brain Res 24:313–319 20. Berns H, Humar R, Hengerer B, Kiefer FN, Battegay EJ (2000) RACK1 is up-regulated in angiogenesis and human carcinomas. FASEB J 14:2549–2558 21. Yoshiji H, Kuriyama S, Ways DK, Yoshii J, Miyamoto Y, Kawata M, Ikenaka Y, Tsujinoue H, Nakatani T, Shibuya M, Fukui H (1999) Protein kinase C lies on the signaling pathway for vascular endothelial growth factor-mediated tumor development and angiogenesis. Cancer Res 59:4413–4418 22. Bouzahzah B, Albanese C, Ahmed F, Pixley F, Lisanti MP, Segall JD, Condeelis J, Joyce D, Minden A, Der CJ, Chan A, Symons M, Pestell RG (2001) Rho family GTPases regulate mammary epithelium cell growth and metastasis through distinguishable pathways. Mol Med 7:816–830 23. Denoyelle C, Vasse M, Ko¨rner M, Mishal Z, Ganne´ F, Vannier JP, Soria J, Soria C (2001) Cerivastatin, an inhibitor of HMGCoA reductase, inhibits the signaling pathways involved in the invasiveness and metastatic properties of highly invasive breast cancer celllines: an in vitro study. Carcinogenesis 22:1139–1148

Breast Cancer Res Treat (2011) 126:555–563 24. Bourguignon LY (2001) CD44-mediated oncogenic signaling and cytoskeleton activation during mammary tumor progression. J Mammary Gland Biol Neoplasia 6:287–297 25. Burridge K, Wennerberg K (2004) Rho and Rac take center stage. Cell 116:167–179 26. Nobes CD, Hall A (1995) Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81:53–62 27. Caron E, Hall A (1998) Identification of two distinct mechanisms of phagocytosis controlled by different Rho GTPases. Science 282:1717–1721 28. Pertz O, Hodgson L, Klemke RL, Hahn KM (2006) Spatiotemporal dynamics of RhoA activity in migrating cells. Nature 440:1069–1072 29. Narumiya S, Tanji M, Ishizaki T (2009) Rho signaling, ROCK and mDia1, in transformation, metastasis and invasion. Cancer Metastasis Rev 28:65–76 30. Amano M, Chihara K, Kimura K, Fukata Y, Nakamura N, Mastuura Y, Kaibuchi K (1997) Formation of actin stress fibers

563

31.

32.

33.

34.

35.

and focal adhesion enhanced by Rho-kinase. Science 275:1308– 1311 Ishizaki T, Uehata M, Tamechika I, Keel J, Nonomura K, Maekawa M, Narumiya S (2000) Pharmacological properties of Y-27632, a specific inhibitor of Rho-associated kinase. Mol Pharmacol 57:976–983 Sahai E, Ishizaki T, Narumiya S, Treisman R (1999) Transformation mediated by Rho requires activity of ROCK kinases. Curr Biol 9:136–145 Itoh K, Yoshioka K, Akedo H, Uehata M, Ishizaki T, Narumiya S (1999) An essential part for Rho-associated kinase in the transcellular invasion of tumor cells. Nat Med 5:221–225 Del Re DP, Miyamoto S, Brown JH (2008) Focal adhesion kinase as a RhoA-activable signaling scaffold mediating Akt activation and cardiomyocyte protection. J Biol Chem 283:35622–35629 Nakaya Y, Sukowati EW, Wu Y, Sheng G (2008) RhoA and microtubule dynamics control cell-basement membrane interaction in EMT during gastrulation. Nat Cell Biol 10:765–775

123