Tumor Biol. DOI 10.1007/s13277-014-2783-2
RESEARCH ARTICLE
Evaluation of NIN/RPN12 binding protein inhibits proliferation and growth in human renal cancer cells Jian-wei Jia & Ai-qin Liu & Yun Wang & Fen Zhao & Li-ling Jiao & Jun Tan Received: 2 October 2014 / Accepted: 27 October 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014
Abstract The targeted delivery of small interfering RNA (siRNA) to specific tumor tissues and tumor cells remains as one of the key challenges in the development of RNA interference as a therapeutic application. The ribosome assembly factor NIN/RPN12 binding protein (NOB1) has been suggested to be essential for processing of the 20S pre-rRNA to the mature 18S rRNA, and is also reported to participate in proteasome biogenesis. However, it is unclear whether NOB1 is involved in tumor cells growth. The aim of this study was to determine whether the suppression of lentivirus mediated NOB1 siRNA inhibits the growth of human clean cell carcinoma (ccRCC) cells, further focused on NOB1 as a possible therapeutic target for renal cell carcinoma treatment. NOB1 deletion that caused significant decline in cell proliferation was observed in both 786-O and ACHN cell lines as investigated by MTT assay. Further, the number and size of the colonies formed were also significantly reduced in the absence of NOB1. Moreover, NOB1 gene knockdown arrested the cell cycle and inhibited cell cycle-related protein expression. The Kaplan-Meier survival curves revealed that low NOB1 expression was associated with poor prognosis in ccRCC patients. Collectively, these results indicate that J.
NOB1 plays an essential role in renal cell cancer cell proliferation, and its gene expression could be a therapeutic target. Keywords Renal cell carcinoma . shRNA . NOB1 . Cellular proliferation
Introduction Renal cell carcinoma (RCC) is a common urologic malignancy that accounts for about 3 % of adult malignancies [1]. RCC is a kidney cancer that originates in the lining of the proximal renal tubule, the very small tubes in the kidney that filter the blood and remove waste products [2, 3]. Renal cell carcinoma is the most common type of kidney cancer and the most common type in adults, responsible for approximately 80 % of cases [4]. The curative effect of surgical resection varied differently in patient population: the 5-year survival rate in stage I, II, III, and IV is about 93, 65, 53, and 27 %, respectively [5, 6]. So it is clear that early diagnosis and medical intervention seems vital in decreasing mortality and promoting total quality of life, novel molecular markers about kidney cancer that can help individually evaluate risk of patient outcome and predict the prognosis are urgently required, as well as the prediction of therapy effect and advocating personalized treatment [7]. NOB1was first identified in Saccharomyces cerevisiae as an essential gene encoding the Nin one binding protein (NOB1p), which can interact with Rpn12p, as demonstrated previously by a two-hybrid assay [8]. The nuclear protein NOB1p serves as a chaperone to join the 20S proteasome with the 19S regulatory particle in the nucleus and facilitates the maturation of the 20S proteasome [9]. Therefore, the function of NOB1p is necessary for UPP-mediated proteolysis [10, 11]. A recent study in chronic myeloid leukemia (CML) reveals that NOB1, along with five other genes, can be used as a diagnostic marker discriminating chronic phase (CP) from blast crisis (BC) CML [12]. Recent studies have been increasingly recognized that abnormal expression of NOB1 plays a significant role in carcinogene [13,
Tumor Biol.
characteristics in our study are presented in Table 1. All patients were followed up until September 2011 with a median observation time of 35 months. Patients had to provide a written consent to participate, and after receiving written information regarding its course and purpose, then they could be enrolled into our observation. Approval for the study was received in advance from the Ethics Committee of our institution.
14]. Li reported NOB1 was higher expressed in breast cancer, compared with normal breast and benign breast tumor tissue [15]. Che also reported NOB1 deletion caused significant decline in cell proliferation in prostate cancer cell lines [16]. NOB1 protein has been found expressed mainly in liver, lung, and spleen [17–19]. However, no study was found accessing the relationship between RNAi and NOB1 abnormal expression and renal cancer. The aim of this study was to determine whether the suppression of lentivirus-mediated NOB1 siRNA inhibits the growth of human clean cell carcinoma (ccRCC) cells, further to investigate the expression of NOB1 in ccRCC tissues and to assess its clinicopathological significance. We applied RNA interference (RNAi) technology to knock down the expression of NOB1 in two renal cancer cell lines, and we then investigated the proliferation, cell cycle, and colony-formation capacity in two cell lines. Our data revealed that the inhibition of NOB1 significantly decreased proliferation in both cell lines, providing us with a future target for therapy.
Cell culture Renal cancer cell line 786-O and ACHN were obtained from Chinese Academy of Sciences (Shanghai, China). The cells were maintained in penicillin/streptomycin-treated DMEM supplemented with 10 % FBS at 37 °C in humidified atmosphere of 5 % CO2. Construction of a NOB1 shRNA lentivirus vector and cell infection Small interfering RNA (siRNA) targeting NOB1 sequence (AAGGTTAAGGTGAGCTCATCG) and non-silencing sequence (AATTCTCCGAACGTGTCACGT) were transformed into short hairpin RNA (shRNA) (stem–loop–stem structure) and were cloned into pLV-THM-lentiviral vectors with BamHI/EcoRI sites. After 3 days of incubation, the lentivirus from culture medium was collected and concentrated with Centricon-plus-20 (Millipore, Billerica, MA, USA); 786-O and ACHN cells were received from Chinese Academy of Sciences (Shanghai, China). Cells were grown in DMEM (Invitrogen, Carlsbad, CA, USA) containing 10 % fetal
Materials and methods Patients A total of 62 patients who underwent surgery at hospitals for histologically proven renal cell carcinoma (ccRCC) that cooperated with National Engineering Center for Biochip at Shanghai during 2008–2010 are selected in this research. They were totally 32 men and 30 women, whose age range from 32 to 79 years (median: 61 years). Clinicopathological Table 1 Correlation of NOB1 expression with clinicopathological characteristics in RCC patients
Characteristics
Number
NOB1 expression
x2
p
−
+
++
+++
High expression (%)
8 6
11 9
9 10
4 5
12.5 16.7
0.008
0.674
6 9
3 11
3 13
5 12
29.4 26.7
0.204
0.781
13 5
10 4
13 7
7 3
16.3 15.8
0.173
0.662
Gender Male 32 Female 30 Age (years) <65 17 >65 45 Tumor Size (cm) <4 43 ≥4 19 cTNM I–II 48 III–IV 14 Lymph node metastasis No 16 Yes 46
9 1
18 3
16 4
5 6
10.4 42.9
4.780
0.012
4 5
7 12
4 17
1 12
6.3 26.1
6.472
0.010
Histological grade I–II 38 III–IV 24
7 4
16 6
13 10
2 4
5.3 16.7
7.643
0.008
Tumor Biol.
bovine serum (FBS; Invitrogen, Carlsbad, CA, USA), 2 mM L-glutamine and 1 % penicillin/streptomycin at 37°C with 5 % CO2. For lentivirus infection, 786-O and ACHN cells were cultured in 6-well plates. After 72 h of infection, cells were observed under fluorescence microscopy (MicroPublisher 3.3, Olympus, Japan). RNA extraction, cDNA preparation, and real-time quantitative PCR analysis Total RNA was extracted from cells using the TRIZOL reagent (Invitrogen). Real-time quantitative PCR was performed using the SYBR-Green Master PCR Mix kit (TAKARA). Expression of mRNA was assessed by evaluating threshold cycle (CT) values. The CT values of the NOB1 were normalized with the expression level of GAPDH. The quantification experiment was done in triplicate for every sample. The primer sequences were as follows: 5′-ATCTGC CCTACAAGCCTAAAC-3′ (forward) and 5′-TCCTCCTC CTCCTCCTCAC-3′ (reverse) for NOB1; 5′-CATGAGAA GTATGACAACAGCCT-3′ (forward), and 5′-AGTCCTTC CACGATACCAAAGT-3′ (reverse) for GAPDH. All samples were examined in triplicate. Western blotting Total protein was isolated from cells infected for 5 days, and the isolated protein was quantified by BSA protein analysis method. Protein (20 μg) was loaded onto a 10 % SDS-PAGE and electrophoresed at 60 V for 4 h. Then, the protein in the gel was transferred to polyvinylidene difluoride membrane following electrophoresis (Millipore). The protein levels were detected by respective antibodies following detection with ECL kit (Amersham) and exposed to X-ray film. The GAPDH was used as control and detected by an anti-GAPDH antibody (Santa Cruz Biotechnology). Bands on X-ray films were quantified with an ImageQuant densitometric scanner (molecular dynamics). Cell proliferation assay Renal cancer cells were seeded into a 96-well plate 5 days after infection at a concentration of 2000 cells/well. MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) analysis was performed in different time intervals (1, 2, 3, 4, and 5 days after incubation) to find the viability of cells at tested time periods. After the specified incubation time, 20 μl of MTT solution (5 mg/ml) was added to each well and incubated at 37 °C for 4 h. Then, the medium and MTT from the wells were removed and 100 μl of DMSO was added to each well. The optical density was measured using a microplate reader at 490 nm.
Wound healing assay Cells after transfection were seeded in 6-well plates and allowed to attach overnight to 80 % confluency. Subsequently, cell monolayers were wounded by pipette tips and washed with PBS twice to remove floating cells. Cells were then incubated in DMEM medium, for up to 24 h. Cells migrated into the wound surface, and the number of migrating cells were determined under an inverted microscopy at various times, five randomly chosen fields were analyzed for each well. The percentage of inhibition was expressed using untreated wells at 100 %. Three independent experiments were performed. Cell colony-formation assay Cells after transfection were seeded in 6-well plates and were incubated at 37 °C for 9 days. The medium was replaced every 3 days. After washing twice with PBS, the colonies were fixed with ice methanol for 30 min and stained with Giemsa for 10 min. Then, the visible colonies were counted. Cell cycle analysis The cell cycle distributions in the infected cells were analyzed using flow cytometer following propidium iodide (PI) staining. The infected cells were seeded on 6-well plates at a cell density of 2.5×105. After 24 h, the cells were collected, washed with ice cold PBS, and were fixed with 75 % ethanol and incubated for another 30 min at 4 °C. The ethanol was removed by centrifugation, and the remaining cell pellets were suspended in 100 μg/ml of DNase-free RNase for 30 min at 37 °C. Finally, the PI solution (100 μg/ml) was added to the cell suspension and analyzed by flow cytometer (FACS Calibur, BD Biosciences) after filtering through a 50-μm nylon mesh. Immunohistochemistry The protein expression of NOB1 in 38 tumor tissues and adjacent normal tissues were detected by immunohistochemistry (IHC). Samples were fixed in 10 % neutral formaldehyde, embedded in paraffin, and sliced. Briefly, the paraffinembedded tissues were serially cut into 4-μm sections, dewaxed, and rehydrated. Sections were then blocked with peroxide and non-immune animal serum and incubated sequentially with rabbit anti-human NOB1 (1:1000), and biotinlabeled mouse IgG secondary antibody (1:1000). Finally, the sections were stained with DBA, counterstained with hematoxylin, dehydrated, cleared in xylene, and fixed. Immunostaining was independently examined by two clinical pathologists who were unaware of the patient outcome. Five highpower fields (×400) were randomly counted for each section.
Tumor Biol.
The brown staining on the cytoplasm was read as positive reactivity for NOB1. The presence of brown colored granules on the cytoplasm was taken as a positive signal and was divided by color intensity into not colored, light yellow, brown, tan, and is recorded as 0, 1, 2, and 3, respectively. We also choose five high-power fields from each slice and score them. Positive cell rate of <25 % was a score of 1, positive cell rate of 25~50 % was a score of 2, positive cell rate of 51~75 % was a score of 3, and positive cell rate of >75 % was a score of 4. The final score was determined by multiplying positive cell rate and score values: 0 was equal to negative (−), 1~4 was equal to weakly positive (+), 5~8 was equal to moderate positive (+ +), 9~12 was equal to strongly positive (+ + +). Statistical analysis All results represent the mean±standard deviation from three independent experiments. The Students t test was used to evaluate the differences between the control cells and NOB1 silenced cells in SPSS 13.0 software. Significant significance was set at P<0.05.
Results Correlation of NOB1 expression with clinicopathological characteristics in RCC patients To determine the potential role of NOB1 in human renal cell carcinoma progression, we evaluated NOB1 expression and cellular localization in 62 surgical specimens of human renal cell cancer by immunohistochemistry. NOB1 protein is elevated in high-grade RCC (WHO grade III and IV) compared with low-grade RCC (WHO grade I and II), suggesting that Fig. 1 Correlation of NOB1 expression with clinicopathological characteristics in rcc patients. a, b In view of the tissue distribution of NOB1 protein, our results showed that it is localized both in the nucleus as well as cytoplasm. c Shown by IHC, the positive cells were expressed as brown particles distributed in the nucleus of tumor cells. Of the renal tumors, the positive rate of NOB1 and βcatenin was 81.6 % (31/38) and 86.8 % (33/38). The difference between them was statistically significant (P<0.05)
this gene is related to RCC malignancy (Table 1). We then identified a correlation between the clinicopathological parameters of RCC patients and NOB1 protein expression. There were significant associations between NOB1 protein expression and TNM stage, lymph node metastasis, and histopathological grade (P<0.05). However, the results demonstrated that the sex and age do not affect NOB1 expression. In view of the tissue distribution of NOB1 protein, our results showed that it is localized both in the nucleus as well as cytoplasm (Fig. 1). NOB1 expression downregulation by NOB1 shRNA lentivirus system The lentivirus carrying the NOB1 siRNA or negative control siRNA were infected into RCC cells. After 3 days, efficient infection was observed. To determine the effect of RNAi on the endogenous expression of NOB1, the mRNA and protein levels of NOB1 were analyzed with real-time RT-PCR and Western blotting, respectively. The infection efficiency of lentivirus was greater than 80 % after 72 h of infection. The RT-PCR assay suggested that NOB1 mRNA level was reduced by about 70 % in both cell lines treated with NOB1 shRNA lentivirus, as compared with the control group. We determined the level of NOB1 protein in cells after 72 h of lentivirus infection via Western blot analysis. In 786-O and ACHN cell lines, the protein expression of NOB1 was significantly reduced by about 50 % through NOB1 shRNA lentivirus treatment (Fig. 2a, b). NOB1 siRNA infection suppressed the proliferation of renal cancer cells The effect of silencing NOB1 on renal cancer cell proliferation was analyzed by MTT assay. It could be clearly observed that
Tumor Biol.
Fig. 2 NOB1 expression downregulation by NOB1 shRNA lentivirus system and NOB1 siRNA infection suppressed the proliferation of renal cancer cells. In 786-O and ACHN cell lines, the protein expression of
NOB1 was significantly reduced by about 50 % through NOB1shRNA lentivirus treatment (a–b). The effect of silencing NOB1 on renal cancer cell proliferation was analyzed by MTT assay (c)
the proliferation of both NOB1 siRNA infected in 786-O and ACHN (Fig. 2c) cell proliferation was time dependently decreased. At the 5th day of observation, the cell viability was significantly (p<0.01) reduced in both cell lines compared to the non-silencing control siRNA-infected cell groups. These results indicate that the higher expression levels of NOB1 are closely related to the proliferation of renal cancer cells.
NOB1 siRNA inhibits renal cancer cell migration in vitro
Colony formation of renal cancer cells were suppressed by the silencing of NOB1 Both 786-O and ACHN cells are growing in groups, and therefore, the effect of NOB1 silencing on this colonyforming ability of renal cancer cells was investigated by performing colony-formation assay following Giemsa staining. The number and the size of the colonies were observed in both NOB1 siRNA-infected cell group and the non-silencing control siRNA-infected group. The reduction in the number and the size of the colonies were clearly observed under the light microscope in NOB1 siRNA-infected 786-O cells (Fig. 3). As shown in Fig. 3a. b, NOB1 siRNA infection significantly (p<0.01) reduced the number of colonies by 57.9 % in 786-O cells and 42.3 % in ACHN cells. Collectively, these results strongly support that in the absence of NOB1, both the number and the size of the colonies are suppressed.
We used a wound-healing assay to test the in vitro effect of NOB1 siRNA on cell migration. We test the cellular migration that 0, 48, and 72 h treatment of NOB1 siRNA in 786-O and ACHN cells. As shown in Fig. 3c, after 72 h, the wound was almost covered in negative control group, whereas NOB1 siRNA-treated cells remain close to the initial state. Furthermore, a clear dose–response effect of NOB1 siRNA was observed; meanwhile, the inhibition percentage of 72 h was about 56.3 %. Infection with NOB1 siRNA arrested the cell cycle of renal cancer cells The effect of NOB1 on the cell cycle progression was analyzed by flow cytometry by using both NOB1 siRNA and nonsilencing control siRNA in RCC cells. The FACS results indicated that NOB1 siRNA significantly increased the percentage of cells in G0/G1 compared to non-silencing siRNA. This increase in the G0/G1 phase was coupled with a significant decrease in the percentage of cells in S and G2 after 48 h of transfection (p<0.05). NOB1 siRNA could arrest cells in the G0/G1 phase at concentrations as low as 100nM in 786-O (p<0.01) and ACHN cells required a higher concentration (150nM) of siRNA to show significant results (p<0.05, Fig. 4).
Tumor Biol.
Fig. 3 Colony formation of renal cancer cells were suppressed by the silencing of NOB1, and NOB1 siRNA inhibits renal cancer cell migration in vitro. As shown, NOB1 siRNA infection significantly (p<0.01)
reduced the number of colonies by 57.9 % in 786-O cells and 42.3 % in ACHN cells. Furthermore, a clear dose–response effect of NOB1 siRNA was observed, the inhibition percentage of 72 h was about 56.3 %
NOB1 protein expression in fresh renal tumor and adjacent normal tissues
tumor cells. Of the 38 renal tumors, the positive rate of NOB1 and β-catenin was 81.6 % (31/38) and 86.8 % (33/38). However, in adjacent normal tissues, the positive rate was 15.8 % (6/38) and 55.3 % (21/38), respectively. The difference between them was statistically significant (P<0.05). As predicted, the expression of NOB1 was also correlated with the expression of β-catenin in both tumor tissues (r=0.312, P<0.05) and adjacent normal tissues (r=0.471, P<0.05).
To further confirm the expression of NOB1 and β-catenin in renal cancer, we detected the expression of NOB1 and βcatenin in fresh renal cancer tissues and adjacent normal tissues of the same patient. Shown by IHC, the positive cells were expressed as brown particles distributed in the nucleus of
Fig. 4 Infection with NOB1 siRNA arrested the cell cycle of renal cancer cells. The effect of NOB1 on the cell cycle progression was analyzed by flow cytometry by using both NOB1 siRNA and non-silencing control siRNA in 786-O and ACHN cells. NOB1 siRNA could arrest cells in the G0/G1 phase at concentrations as low as 100nM in 786-O (p<0.01) and ACHN cells required a higher concentration (150 nM) of siRNA to show significant results (p<0.05). The Kaplan–Meier survival curves revealed that low NOB1 expression was associated with poor prognosis in ccRCC patients
Tumor Biol.
NOB1 expression and survival analysis: univariate survival analysis Follow-up information was available for 62 patients until September 2011; within the observation period, there were 21 renal cancer-related deaths with a median follow-up time of 35 months (0–60 months). And the remaining 41 patients were still alive or lost to follow-up with a median follow-up time of 54 months ranging (38–60 months). Survival analysis by Kaplan-Meier survival curve and log-rank test demonstrated that patients with higher expression of NOB1 in tumor tissue had a better overall survival than patients with tumor with lower expression (p<0.05), the 5-year survival rate of patients with higher expression was significantly lower than that of patients with lower expression (35.6 vs. 59.8 %). The survival curve was demonstrated in Fig. 4c.
Discussion Renal cell carcinoma is the most lethal urologic tumor and the sixth leading cause of cancer-related mortality in Western countries [20, 21]. This study was focused to identification of an oncogenic target in renal cancer cells and investigation of the effects of silencing the respective gene on renal cancer cell proliferation. The proliferation rate, colony-forming ability, and the cell cycle progression was strongly inhibited by the absence of NOB1. Hence, it is clear that NOB1 has played an important role in the proliferation and progression of renal cancer cells. NOB1, identified as a interacting partner with RPN12p by a yeast two-hybrid screening, is essential for processing the 20S pre-rRNA to the mature 18S rRNA [9, 22]. NOB1 is also reported to participate in proteasome biogenesis [10]. NOB1 was also found expressed in a lot of normal tissues [23], indicating that NOB1 might be involved in many physiologic activities [24, 25]. NOB1 has been reported highly expressed in esophageal cancer as compared with normal esophageal tissues, indicating that NOB1 might play important roles in tumorigenesis [14]. Further study reveals that suppression of NOB1 inhibits renal cell proliferation and migration [26]. Our study highlights critical roles for NOB1 in the occurrence and development of human RCC and provides new evidence for the involvement of NOB1 in carcinogenesis and suggests that RNAi directed NOB1 silencing may be a potent therapeutic tool for the treatment of RCC. We will continue to work on the molecular mechanism by which NOB1 influences RCC cell biology. In this study, we presumed that NOB1 may act as an oncogenic factor in renal cancer development. Given the prevalence and availability of RNAi technology in cancer research or cancer therapy [27], we used a RNAi system that
can effectively knock down the expression of NOB1 at both the RNA and protein levels [28, 29]. As shown in Fig. 2, qRT-PCR and Western blot analysis showed sufficient silencing of NOB1, thus ensuring the credibility of the subsequent assays. Predictably, reduced expression of NOB1 in both renal cell lines greatly decreased cancer cell proliferation, as confirmed by MTT cell proliferation assays. Intriguingly, our data reveal that sh-NOB1 had an inhibitory effect on renal cancer cell growth via G0/G1 arrest. The immunohistochemistry stain showed the expression pattern of NOB1 protein, mainly in the nucleus of RCC cells, was in accordance with previous reports [9, 14, 24]. These data were similar to previous reports of NOB1 and cancer [16, 18, 30]. We also found that high NOB1 protein expression was with significant associations between and TNM stage, lymph node metastasis, and histopathological grade. The biological function and therapeutic potential of NOB1, a key factor in the UPP and proteasome complex, remain to be fully elucidated. Loss of the tumor suppressor genes β catenin has been suggested to enable metastasis by disrupting intercellular contacts, which is an early step in metastatic dissemination. Cai et al. demonstrated that the wingless type MMTV integration site family (Wnt)/β catenin pathway is inactivated in osteosarcoma [31]. Moreover, activation of the Wnt/β catenin pathway inhibits cell proliferation and promotes osteogenic differentiation in osteosarcoma cells. The present results indicate that NOB1 depletion may inhibit osteosarcoma development by increasing β catenin expression. The results showed NOB1 plays an important role in the occurrence and development of RCC. However, the reason and mechanism of NOB1 overexpression is still unclear. Further researches are needed. In this study, we demonstrated that NOB1 specific RNAi transfection downregulated the expression of NOB1, which is expressed in a high fraction in renal cancer. We also found out that NOB1-specific RNAi inhibited the proliferation of renal cancer cells, promoted their apoptosis, and arrested these cells in the G0/G1 phase. In conclusion, we have shown that the NOB1 expression level maybe an indicator of the aggressiveness of RCC.
Conclusion The present study proved for the first time that RNAimediated knockdown of NOB1 suppresses the growth and colony-formation ability of renal cancer cells. In addition, NOB1 inhibition arrests the cell cycle in the G0/G1 phase. The Kaplan–Meier survival curves revealed that low NOB1 expression was associated with poor prognosis in ccRCC patients. Our data indicated that NOB1 may serve as an oncogene in renal cancer development. Therefore, NOB1
Tumor Biol.
has considerable potential to be a new therapeutic target for the treatment of RCC.
Conflicts of interest None.
References 1. Miyamoto H, Miller JS, Fajardo DA, Lee TK, Netto GJ, Epstein JI. Non-invasive papillary urothelial neoplasms: the 2004 WHO/ISUP classification system. Pathol Int. 2010;60:1–8. 2. Mulders PF, Brouwers AH, Hulsbergen-van der Kaa CA, van Lin EN, Osanto S and de Mulder PH. [Guideline’Renal cell carcinoma’]. Ned Tijdschr Geneeskd 2008; 152: 376–380. 3. Zhang G, Zhang Z, Liu Z. Polo-like kinase 1 is overexpressed in renal cancer and participates in the proliferation and invasion of renal cancer cells. Tumour Biol. 2013;34:1887–94. 4. Parker AS, Eckel-Passow JE, Serie D, Hilton T, Parasramka M, Joseph RW, Wu KJ, Cheville JC and Leibovich BC. Higher Expression of Topoisomerase II Alpha Is an Independent Marker of Increased Risk of Cancer-specific Death in Patients with Clear Cell Renal Cell Carcinoma. Eur Urol 2013; 5. Mulders PF. Renal cell carcinoma. World J Urol. 2008;26:113. 6. Rini BI, Campbell SC, Escudier B. Renal cell carcinoma. Lancet. 2009;373:1119–32. 7. Li W, Zhu W, Che J, Sun W, Liu M, Peng B, et al. Microarray profiling of human renal cell carcinoma: identification for potential biomarkers and critical pathways. Kidney Blood Press Res. 2013;37: 506–13. 8. Kluge R, Giesen K, Bahrenberg G, Plum L, Ortlepp JR, Joost HG. Quantitative trait loci for obesity and insulin resistance (Nob1, Nob2) and their interaction with the leptin receptor allele (LeprA720T/ T1044I) in New Zealand obese mice. Diabetologia. 2000;43:1565–72. 9. Veith T, Martin R, Wurm JP, Weis BL, Duchardt-Ferner E, Safferthal C, et al. Structural and functional analysis of the archaeal endonuclease Nob1. Nucleic Acids Res. 2012;40:3259–74. 10. Tone Y, Toh EA. Nob1p is required for biogenesis of the 26S proteasome and degraded upon its maturation in Saccharomyces cerevisiae. Genes Dev. 2002;16:3142–57. 11. Fatica A, Oeffinger M, Dlakic M, Tollervey D. Nob1p is required for cleavage of the 3′ end of 18S rRNA. Mol Cell Biol. 2003;23:1798– 807. 12. Oehler VG, Yeung KY, Choi YE, Bumgarner RE, Raftery AE, Radich JP. The derivation of diagnostic markers of chronic myeloid leukemia progression from microarray data. Blood. 2009;114:3292–8. 13. Li W, Liu M, Feng Y, Xu YF, Huang YF, Che JP, Wang GC, Yao XD and Zheng JH. Downregulated miR-646 in clear cell renal carcinoma correlated with tumour metastasis by targeting the nin one binding protein (NOB1). Br J Cancer 2014; 14. Deschamps C. Retraction. Up-regulation of NOB1 in esophageal squamous cell carcinoma (p). Dis Esophagus 2008; 21: 574. 15. Li XY, Luo QF, Li J, Wei CK, Kong XJ, Zhang JF, et al. Clinical significance of NOB1 expression in breast infiltrating ductal carcinoma. Int J Clin Exp Pathol. 2013;6:2137–44.
16. Che JP, Li W, Yan Y, Liu M, Wang GC, Li QY, et al. Expression and clinical significance of the nin one binding protein and p38 MAPK in prostate carcinoma. Int J Clin Exp Pathol. 2013;6:2300–11. 17. Ettinger DS, Akerley W, Borghaei H, Chang AC, Cheney RT, Chirieac LR, et al. and Nccn. Non-small cell lung cancer. J Natl Compr Cancer Netw. 2012;10:1236–71. 18. Liu K, Gu MM, Chen HL and You QS. NOB1 in Non-small-cell Lung Cancer: Expression Profile and Clinical Significance. Pathol Oncol Res 2013; 19. Pertschy B, Schneider C, Gnadig M, Schafer T, Tollervey D, Hurt E. RNA helicase Prp43 and its co-factor Pfa1 promote 20 to 18S rRNA processing catalyzed by the endonuclease Nob1. J Biol Chem. 2009;284:35079–91. 20. Kim SP, Crispen PL, Thompson RH, Weight CJ, Boorjian SA, Costello BA, et al. Assessment of the pathologic inclusion criteria from contemporary adjuvant clinical trials for predicting disease progression after nephrectomy for renal cell carcinoma. Cancer. 2012;118:4412–20. 21. Rosa R, Damiano V, Nappi L, Formisano L, Massari F, Scarpa A, et al. Angiogenic and signalling proteins correlate with sensitivity to sequential treatment in renal cell cancer. Br J Cancer. 2013;109:686– 93. 22. Li Y, Ma C, Qian M, Wen Z, Jing H, Qian D. Downregulation of NOB1 suppresses the proliferation and tumor growth of non-small cell lung cancer in vitro and in vivo. Oncol Rep. 2014;31:1271–6. 23. Han Y, Hong L, Qiu J, Qiao L, Zhong C, Xue T, et al. Preparation and characterization of a novel monoclonal antibody specific to human NOB1 protein. Hybridoma (Larchmt). 2008;27:187–90. 24. Zhang Y, Ni J, Zhou G, Yuan J, Ren W, Shan Y, et al. Cloning, expression and characterization of the human NOB1 gene. Mol Biol Rep. 2005;32:185–9. 25. Lamanna AC, Karbstein K. Nob1 binds the single-stranded cleavage site D at the 3′-end of 18S rRNA with its PIN domain. Proc Natl Acad Sci U S A. 2009;106:14259–64. 26. Li W, Liu M, Xu YF, Feng Y, Che JP, Wang GC, et al. Combination of quercetin and hyperoside has anticancer effects on renal cancer cells through inhibition of oncogenic microRNA-27a. Oncol Rep. 2014;31:117–24. 27. Mahon TM, Brennan P, O’Neill LA. Evidence for a redox-sensitive protein tyrosine kinase in nuclear factor kappa B activation and interleukin 2 production in EL4.NOB1 cells. Biochem Soc Trans. 1993;21:389S. 28. Garimella SV, Gehlhaus K, Dine JL, Pitt JJ, Grandin M, Chakka S, et al. Identification of novel molecular regulators of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis in breast cancer cells by RNAi screening. Breast Cancer Res. 2014;16:R41. 29. Unger GM, Kren BT, Korman VL, Kimbrough TG, Vogel RI, Ondrey FG, et al. Mechanism and efficacy of Sub-50-nm tenfibgen nanocapsules for cancer cell-directed delivery of anti-CK2 RNAi to primary and metastatic squamous cell carcinoma. Mol Cancer Ther. 2014;13:2018–29. 30. Lin Y, Peng S, Yu H, Teng H, Cui M. RNAi-mediated downregulation of NOB1 suppresses the growth and colony-formation ability of human ovarian cancer cells. Med Oncol. 2012;29:311–7. 31. Cai Y, Mohseny AB, Karperien M, Hogendoorn PC, Zhou G, CletonJansen AM. Inactive Wnt/beta-catenin pathway in conventional highgrade osteosarcoma. J Pathol. 2010;220:24–33.
