Tumor Biol. DOI 10.1007/s13277-015-3301-x

RESEARCH ARTICLE

Squalene epoxidase (SQLE) promotes the growth and migration of the hepatocellular carcinoma cells Zhenghui Sui & Jiahua Zhou & Zhangjun Cheng & Penhua Lu

Received: 15 January 2015 / Accepted: 1 March 2015 # International Society of Oncology and BioMarkers (ISOBM) 2015

Abstract Hepatocellular carcinoma (HCC) is one of the most common malignancies with a poor response to chemotherapy. It is very important to identify novel therapeutic targets. Squalene epoxidase (SQLE), one of the rate-limiting enzymes in the cholesterol biosynthesis, recently has been found to be involved in the tumorigenesis. However, its expression profile and function in the progression of HCC remain largely unknown. Here, we found that the expression of SQLE was upregulated in the HCC tissues. Moreover, overexpression of SQLE in HCC cells promoted cell proliferation and migration, while downregulation of SQLE inhibited the tumorigenicity of HCC cells in vitro and in vivo. Mechanistically, SQLE positively regulated the ERK signaling. Taken together, our study suggests that SQLE is a promising therapeutic target in HCC. Keywords HCC . SQLE . ERK . Cell proliferation and migration

Introduction Hepatocellular carcinoma (HCC) is one of the common malignancies in the world. In China, HCC ranks the third leading cause of cancer-related death [1]. The infection of hepatitis B Z. Sui : J. Zhou (*) : Z. Cheng Department of General Surgery, Zhongda Hospital, School of Medicine, Southeast University, 87 Dingjiaqiao Rd, Nanjin 210009, Jiangsu Province, China e-mail: [email protected] P. Lu Department of Medical Oncology, Wuxi People’s Hospital Affiliated Nanjing Medical University, No.299, Qingyang Road, Wuxi 214023, Jiangsu, China

virus and hepatitis C virus is one of the major risk factors for this malignancy [2, 3]. Despite of the progress in surgical techniques and liver transplantation, the prognosis for the HCC patients is still very poor due to the tumor aggressive metastasis and recurrence [4]. Thus, it is necessary to identify novel therapeutic targets to improve the outcome of patients with HCC. The rapidly growing cancer cells require a high uptake of cholesterol because cholesterol is not only the essential component of cell membrane but also crucial for the biosynthesis of mevalonate [5, 6]. HMG-CoA reductase has been proved to be the rate-limiting enzyme in cholesterol biosynthesis [7, 8]. However, other enzymes involved in cholesterol biosynthesis, such as HMG-CoA synthase, farnesyl diphosphate synthase, squalene synthase, and squalene epoxidase (SQLE) are also very important for this biological process [9]. SQLE is located in the endoplasmic reticulum and catalyzes the conversion of squalene to 2,3(S)-oxidosqualene [10]. Dysregulation of SQLE in the cancer cells has been reported. Frequent Myc gene amplification and DNA hypomethylation of SQLE promoter were observed in aggressive breast cancer and indicated poor outcome [11]. Also, SQLE and other genes involved in cholesterol biosynthesis were important for the radioresistance in pancreatic cancer [12, 13]. In colorectal cancer, low expression level of SQLE was associated with a better prognosis in patients [14]. In addition, SQLE was found to be differentially expressed in human primary lung squamous cell carcinoma [15]. However, the expression profile and the biological function of SQLE in HCC remain poorly understood. In this study, we showed that the expression level of SQLE was increased in HCC tissues. Moreover, forced expression of SQLE in HCC cells promoted cell growth and migration, while knocking down expression of SQLE inhibited the tumorigenicity of HCC cells. Mechanistically, SQLE was found to activate ERK signaling. Taken together, our study

Tumor Biol.

suggested that upregulation of SQLE was very important in the progression of HCC, and inhibiting the function of SQLE might be a promising therapeutic strategy for HCC.

Materials and methods Cell culture Human normal hepatocellular cell line Chang and HCC cell lines Hep3B, 7404, HepG2, and MHCC97 were purchased from American Type Culture Collection (ATCC) and cultured in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10 % fetal bovine serum (FBS; PAA Laboratories, Pasching, Austria), 10 U/ml penicillin G, and 10 mg/ml streptomycin. All cells were incubated at 37 °C in a humidified atmosphere containing 5 % CO2. Clinical samples Primary tissues were collected from patients who received surgery for HCC at Zhongda Hospital and Danyang People’s Hospital. All of the patients have given informed consent. Dissected samples were frozen immediately after surgery and stored at −80 °C until needed. Plasmid construction and transfection To generate the SQLE expression vector, the open reading frame of human SQLE complementary DNA (cDNA) was cloned into the expression vector pcDNA3.1. The SQLE expression vector and empty pcDNA3.1 were transfected into HepG2 and 7404 cells using Lipofectamine 2000 reagent (Invitrogen). The transfected cells were selected in the presence of 600 μg/ml G418, and resistant cells were pooled and further confirmed the expression of exogenous SQLE by Western blot. RNA extraction and real-time PCR analysis Total RNA was isolated from HCC tissues and matched normal tissues of HCC patients after their informed consent using TRIzol reagent (Invitrogen). The RNA samples were separated in 2 % agarose gels containing ethidium bromide, and their quality was then determined by visibility of 18S and 28S RNA bands under UV light. Two micrograms of total RNA with high quality was processed directly to cDNA with the reverse transcription kit (Promega, Madison, WI), following the manufacturer’s instructions, in a total volume of 25 μl. The primer pair used for amplification of the human SQLE gene was as follows: forward primer, 5′-TGGTTACATGATTCATGATC-3′, and reverse primer, 5′-TACTGAACTCCCATCACAAC-3′. As

an internal standard, a fragment of human beta-actin was amplified by PCR using the following primers: forward primer, 5′-GATCATTGCTCCTCCTGAGC-3′, and reverse primer, 5′-ACTCCT GCTTGCTGATCCAC-3′. Amplification reactions were performed in a 20 μl volume of the LightCyclerDNA Master SYBR Green I mixture from Roche Applied Science as follows: with 10 pmol of primer, 2 mM MgCl2, 200 μM dNTP mixture, 0.5 units of Taq DNA polymerase, and universal buffer. All of the reactions were performed in triplicate in an iCycler iQ System (Bio-Rad), and the thermal cycling conditions were as follows: 95 °C for 3 min; 40 cycles of 95 °C for 30 s, 58 °C for 20 s, and 72 °C for 30 s; 72 °C for 10 min. To confirm specificity of amplification, the PCR products from each primer pair were subjected to a melting curve analysis and electrophoresis in 2 % agarose gel. Western blot analysis Cells were plated into 35-mm dishes and cultured to 80 % confluence. The cells were then scraped and lysed in RIPA buffer, and cell lysates were centrifuged at 10,000×g (4 °C for 20 min). Protein concentrations were determined using Bradford reagent (Sigma) according to the manufacturer’s instructions. Equal amounts of total cellular protein were mixed with loading buffer (62.5 mM Tris–HCl, pH 6.8, 10 % glycerol, 2 % sodium dodecyl sulfate (SDS), 2 % betamercaptoethanol, and bromphenol blue), boiled for 5 min, and subjected to 10 % SDS-PAGE. Proteins were transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were blocked with Tris-buffered saline containing 0.05 % Tween 20 (TBST) and 5 % fat-free dry milk for 1 h at room temperature and incubated overnight with primary antibodies in TBST with 1 % bovine serum albumin. After washing with TBST, the membranes were further incubated for 1 h at room temperature with corresponding horseradish peroxidase-conjugated secondary antibody in appropriate dilution and then washed five times with the same buffer. The immunoreactive protein bands were visualized by ECL kit (Pierce). Antibodies to SQLE and GAPDH were purchased from Santa Cruz Biotechnology, and antibody to phosphorylated ERK was purchased from Cell Signaling Technology. RNAi-mediated knockdown of SQLE In our experiments, FG12 lentiviral vector, which has an independent open reading frame of green fluorescence protein (GFP), was used to produce small, double-stranded RNA (siRNA) to inhibit target gene expression in MHCC97 and HepG2 cells. To construct the hairpin siRNA expression cassette, complementary DNA oligonucleotides for siRNA of SQLE (si SQLE) or mutated sequence as control (si con) were synthesized, annealed, and inserted into FG12. Two SQLE siRNA constructs were used as follows: SQLE siRNA 1#

Tumor Biol.

(highlighted sequence was the complementary sequence with SQLE messenger RNA (mRNA)), 5′-ACCGGGCGCAGA AAAGGAACCATTCAAGAGATGGTTCCTTTTCTG CGCCTTTTTTGGATCCC-3′ and 5′-TCGAGGGATCCA AAAAGGGCGCAGAAAAGGAACCATCTCTTGA ATGGTTCCTTTTCTGCGCC-3′ and SQLE siRNA 2# (highlighted sequence was the complementary sequence with SQLE mRNA), 5′-ACCGGGAGATACAGTGGAAG GTTTCAAGAGAACCTTCCACTGTATCTCCTTTTTT GGATCCC-3′ and 5′-TCGAGGGATCCAAAAAGGGAG ATACAGTGGAAGGTTCTCTTGAAACCTTCCACT GTATCTCC-3′; sicon vector (highlighted sequence was the random sequence as control that was not related to SQLE mRNA), 5′-ACCGGTACATAGGGACGTAACGTTCA AGAGACGTTACGTCCCTATGTACCTTTTTGGATC CC-3′ and 5′-TCGAGGGATCCAAAAAGGTACATAGGG ACGTAACGTCTCTTGAACGTTACGTCCCTATGT AC-3′. FG12 vector with si SQLE or si con was transfected into HEK293T, and the virus with SQLE siRNA or si con was harvested from culture medium. The harvested virus was purified by centrifugation at 25,000×g (4 °C, 150 min), and appropriate amounts of virus were used to infect HepG2 and MHCC97 cells. After 3 days of infection, the GFP-positive cells were sorted by flow cytometry (BD Biosciences), which all stably expressed si SQLE or si con.

(Abbott), an aqueous solution of luciferin (150 mg/kg intraperitoneally) was injected 10 min before imaging. The animals were placed into a light-tight chamber of the CCD camera system (Xenogen), and the photons emitted from the luciferase expressing cells within the animal were quantified for 1 min, using the software program Living Image (Xenogen) as an overlay on Igor (Wavemetrics).

Immunohistochemistry

Boyden chamber assay

HCC tissues were fixed in formalin, embedded in paraffin, and 5-μm-thick consecutive sections were cut and mounted on glass slides. After deparaffin and antigen recovery, the sections were washed thrice in 0.01 mol/l phosphatebuffered saline (PBS) (8 mmol/l Na 2 HPO 4 , 2 mmol/l NaH2PO4, and 150 mmol/l NaCl) for 5 min each, blocked for 1 h in 0.01 mol/l PBS supplemented with 0.3 % Triton X-100 and 5 % normal goat serum, followed by addition of anti-SQLE (1:100) antibody at 4 °C overnight. After brief washes in 0.01 mol/l PBS, sections were exposed for 2 h to 0.01 mol/l PBS containing horseradish peroxidaseconjugated secondary antibody (1:500), followed by development with 0.003 % H2O2 and 0.03 % 3,30-diaminobenzidine in 0.05 mol/l Tris–HCl (pH 7.5).

Boyden chambers (8 μm pore size polycarbonate membrane) were obtained from Neuroprobe Corporation, Bethesda, MD, USA. Cells (2×105) in 0.05 ml medium containing 1 % FBS were placed in the upper chamber, and the lower chamber was loaded with 0.152 ml medium containing 10 % FBS. After 10 h of incubation, cells migrated to the lower surface of filters was detected with traditional H&E staining, and five fields of each well were counted. Three wells were examined for each cell type, and the experiments were repeated for at least three times.

In vivo metastasis assay The HepG2-luciferase stable cell line (overexpression of luciferase) was established with G418 selection. Luciferase expression was determined by using luciferin (Xenogen) and an in vivo imaging system (Xenogen). The luciferase-expressing HepG2/si con cells and luciferase-expressing HepG2/si SQLE cells (1×106 cells in 200 μl PBS) were injected into the left ventricle of the nude mice. The metastasis lesions were monitored every week. Before mice were anesthetized with Forane

Crystal violet assay For cell growth assay, equal number of cells were seeded in 6well plates and cultured in medium supplemented with 10 % FBS for 7 days. Medium was changed every other day. Cell growth was stopped after 7 days in culture by removing the medium and adding 0.5 % crystal violet solution in 20 % methanol. After staining for 5 min, the fixed cells were washed with PBS and photographed. Soft agar assay For clonogenic assay, cells were plated into 6-well flat-bottomed dishes using a two-layer soft agar system with 1.0×104 cells per well in a volume of 1 ml per well. After 14 days of incubation, the colonies were counted and measured. All of the experiments were done at least three times.

Statistics analysis Data are presented as mean±SD. Data were analyzed via the Student’s t test using GraphPad Prism 5.0 software. The statistical difference P<0.05 was considered to be significant.

Results SQLE is overexpressed in HCC tissues and cell lines The expression profile of SQLE in the HCC tissues and adjacent normal tissues was first examined using real-time PCR. The average expression of SQLE in the HCC tissues was

Tumor Biol.

To further explore the function of SQLE in the growth and migration of HCC cells, SQLE expression vector was constructed and then transfected into HepG2 and 7404 cells. As shown in Fig. 2a, the transfection of SQLE expression vector significantly upregulated the expression of SQLE in HepG2 and 7404 cells. The crystal violet assays showed that upregulation of SQLE in HepG2 and 7404 cells

significantly increased their growth compared with control cells (Fig. 2b). We also examined the effect of SQLE on the migration of HCC cells via Boyden chamber assay. The results showed that force overexpression of SQLE significantly increased the migration potential of HepG2 and 7404 cells (Fig. 2c). Moreover, compared with the control cells, upregulation of SQLE enhanced the anchorage-independent growth of HCC cells (Fig. 2d). Collectively, these results suggested that SQLE overexpression had the potential to promote the growth, migration, and anchorage-independent growth of HCC cells. To further study the biological function of endogenously expressed SQLE, we constructed three lentivirus-delivered vectors: two SQLE-specific siRNA vectors (si SQLE 1# and si SQLE 2#) and a control siRNA vector (si con). As shown in Fig. 3a, both of the SQLE-targeting lentivirus vectors decreased the expression of SQLE in HepG2 and MHCC97 effectively. In the in vitro cell growth and migration assay, it was observed that downregulation of SQLE significantly inhibited the growth and migration of HCC cells (Fig. 3b–c). Consistent with these observations, knocking down the expression of SQLE impaired the anchorage-independent growth of MHCC97 cells on soft agar (Fig. 3d). Taken together, downregulated expression of SQLE inhibited the malignant properties of HCC cells.

Fig. 1 Increased expression level of SQLE was found in HCC. a Relative mRNA level of SQLE in human HCC samples and normal tissues. Real-time PCR was performed on 40 HCC samples and 40 normal tissues. The SQLE expression was normalized to that of betaactin. b The protein level of SQLE in HCC tissues and paired normal

tissues was examined by Western blot. c The protein level of SQLE in HCC samples and paired normal tissues was examined by immunohistochemistry. d The protein level of SQLE in normal liver cell lines (Chang) and HCC cell lines (Hep3B, 7404, MHCC97, and HepG2)

significantly higher than that in the adjacent normal tissues (Fig. 1a) (P<0.001). To further confirm these observations, Western blot analysis was performed using six human HCC specimens and paired adjacent normal tissues. The results showed that HCC tissues had drastically increased SQLE expression compared with the matched non-cancerous tissues (Fig. 1b), which was consistent with the protein level of SQLE determined by immunohistochemical staining (Fig. 1c). In addition, Western blot analysis of cell lysate from normal liver cell line (Chang) and HCC cell lines (Hep3B, HepG2, MHCC97, and 7404) indicated that SQLE was highly expressed in the HCC cell line and had lower expression in the normal liver cell line (Fig. 1d). These results indicated that SQLE expression closely correlated with the progression of HCC. SQLE promoted the growth, migration, and anchorage-independent growth of HCC cells

Tumor Biol. Fig. 2 Overexpression of SQLE promoted the growth and migration of HepG2 and 7404 cells. a The HepG2 and 7404 cells were stably transfected with either the pcDNA3.1 vector or the SQLE expression vector. G418resistant cells were pooled and confirmed the expression of exogenous SQLE by Western blot analysis. b The effects of SQLE on the growth of HepG2 and 7404 cells were measured by crystal violet assay. c The effects of SQLE on the migration of HepG2 and 7404 cells. d The effects of SQLE on the anchorageindependent growth of 7404 cells were measured by soft agar assay

SQLE promoted cell growth through activating ERK signaling It has been reported that the derivates from mevalonate pathway plays an important role in the activation of ERK signaling. To gain insight into the molecular mechanism through which SQLE promoted the growth and migration of SQLE cells, we first examined whether overexpression of SQLE could activate ERK signaling. Overexpression of SQLE in Fig. 3 Knocking down the expression of SQLE inhibited the growth and migration of MHCC97 and HepG2 cells. a Knocking down the expression of SQLE in MHCC97 and HepG2 cells. b The growth of SQLE siRNA cells and control cells was measured by crystal violet assay. c Knocking down the expression of SQLE inhibited the migration of MHCC97 and HepG2 cells. d Knocking down the expression of SQLE inhibited the anchorageindependent growth of MHCC97 cells measured by soft agar assay. Data shown was the representative results from three independent experiments

7404 and HepG2 cells significantly stimulated the phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2) (Fig. 4a), indicating the activation of ERK signaling. Consistent with these observations, knocking down the expression of SQLE in MHCC97 cells effectively downregulated the phosphorylation level of ERK (Fig. 4b). These results suggested that SQLE could modulate the activation of ERK signaling in HCC cells. Moreover, silencing the expression of ERK abolished the promoting effects of SQLE on the growth

Tumor Biol.

Fig. 4 SQLE activated ERK signaling. a Overexpression of SQLE stimulated the phosphorylation of ERK1/2 in HepG2 and 7404 cells. b Knocking down the expression of SQLE inhibited the phosphorylation of ERK1/2 in MHCC97 cells. c Knocking down the expression of ERK abolished the promoting effects of SQLE on the growth of HCC cells

of HCC cells (Fig. 4c), indicating that SQLE promoted the growth of HCC cells through activating ERK signaling. Knocking down the expression of SQLE inhibited the metastasis of HCC cells in vivo Our in vitro studies suggested that knockdown of SQLE inhibited the migration of HCC cells. Therefore, we evaluated whether knocking down the expression of SQLE in HCC cells could inhibit the metastasis of HCC cells in vivo by utilizing a tumor metastasis mouse model. HepG2-luc cells knocking down the expression of SQLE were injected into SCID mice through tail vein. Knocking down the expression of SQLE decreased the number of metastasis foci compared with control group (Fig. 5a), which was confirmed by the luciferase signal intensity (Fig. 5b). Therefore, downregulation of SQLE impaired the metastasis of HCC cells in vivo.

Discussion Dysregulation of SQLE has been observed in several cancer types, including breast cancer, lung cancer, and colorectal cancer [11–15]. However, the expression profile and the function of SQLE in hepatocellular carcinoma remain largely unknown. Here, it has been found that upregulation of SQLE in HCC promoted the growth and migration of HCC cells, while knocking down the expression of SQLE inhibited the growth, migration, and metastasis of cancer cells in vitro and in vivo. These observations suggested that SQLE and the cholesterol pathway played an important role in the progression of HCC.

Fig. 5 Downregulation of SQLE impaired the metastasis of HepG2 cells in vivo. a Monitoring metastasis of bioluminescent HepG2/si con and HepG2/si SQLE cells. Images were obtained 7, 14, 21, 28, and 35 days after injection, respectively. b Mean photon counts of each group of mice were quantified and were displayed over time. Each point represented the mean±SD. *P<0.05; **P<0.01

Several studies have demonstrated the importance of mevalonate pathway in the tumorigenesis [16, 17]. Also, one of the rate-limiting enzyme HMG-CoA reductase has shown the activity of transforming MEF cells [18]. On the other hand, statin, the inhibitors of HMG-CoA reductase, has shown the anti-tumor effects, and the use of statins is associated with reduced cancer-related mortality, which further confirmed the important function of mevalonate pathway in the carcinogenesis [19, 20]. Consistently, we have found that SQLE promoted the growth and migration of HCC cells, which further suggested the important function of mevalonate pathway in the progression of HCC. Moreover, in our study, SQLE was observed to activate ERK signaling in our study, which has been reported as an effector of mevalonate pathway. Taken together, these observations suggested that SQLE promoted cell growth and migration through activating mevalonate pathway, and targeting cholesterol synthesis pathway will provide a promising therapeutic approach.

Tumor Biol.

The modification of numerous proteins with farnesyl and geranylgeranyl isoprenoid groups is very important for cell growth, and most of the farnesyl and geranylgeranyl isoprenoid groups are derived from the metabolism of mevalonate [21, 22]. Statin acts as the agents to lower plasma cholesterol levels by inhibiting the activity of HMG-CoA reductase [23, 24]. As a result, the use of statin causes the depletion of both mevalonate-derived non-sterol metabolite(s) as well as sterols which play important roles in the regulation of normal cellular processes [25]. Since, SQLE is situated after this branch point in the mevalonate pathway, and inhibition of SQLE would not affect the production of both mevalonate-derived nonsterol metabolite(s) as well as sterols. Therefore, SQLE is considered to be a potential new target enzyme for the cancer therapy. Conflicts of interest None

References 1. Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics. CA Cancer J Clin. 2014;64(1):9–29. 2. Crispo A, Barba M, Malvezzi M, Ciliberto G, Montella M. Mortality trend for liver cancer in a hyperendemic area of hepatitis C virus infection in southern Italy: join-point analysis and comparison with European and Italian data. Eur J Gastroenterol Hepatol. 2014;26(2): 245–6. 3. Xing S, Li ZW, Tian YF, Zhang LM, Li MQ, Zhou P. Chronic hepatitis virus infection increases the risk of pancreatic cancer: a metaanalysis. Hepatobiliary Pancreat Dis Int. 2013;12(6):575–83. 4. Chen WT, Yang CH, Wu CC, Huang YC, Chai CY. Aberrant deleted in liver cancer-1 expression is associated with tumor metastasis and poor prognosis in urothelial carcinoma. APMIS. 2013;121(12): 1131–8. 5. Houten SM, Schneiders MS, Wanders RJ, Waterham HR. Regulation of isoprenoid/cholesterol biosynthesis in cells from mevalonate kinase-deficient patients. J Biol Chem. 2003;278(8):5736–43. 6. Wanders RJ, Romeijn GJ. Cholesterol biosynthesis, peroxisomes and peroxisomal disorders: mevalonate kinase is not only deficient in Zellweger syndrome but also in rhizomelic chondrodysplasia punctata. J Inherit Metab Dis. 1998;21(3):309–12. 7. Alberts AW. Lovastatin and simvastatin—inhibitors of HMG CoA reductase and cholesterol biosynthesis. Cardiology. 1990;77 Suppl 4: 14–21. 8. Tabacik C, Aliau S, Serrou B. Crastes de Paulet A. Post-HMG CoA reductase regulation of cholesterol biosynthesis in normal human lymphocytes: lanosten-3 betal-ol-32-al, a natural inhibitor. Biochem Biophys Res Commun. 1981;101(4):1087–95. 9. Seiki S, Frishman WH. Pharmacologic inhibition of squalene synthase and other downstream enzymes of the cholesterol synthesis pathway: a new therapeutic approach to treatment of hypercholesterolemia. Cardiol Rev. 2009;17(2):70–6. 10. Trapani L, Segatto M, Ascenzi P, Pallottini V. Potential role of nonstatin cholesterol lowering agents. IUBMB Life. 2011;63(11): 964–71.

11. Parris TZ, Kovacs A, Hajizadeh S, Nemes S, Semaan M, Levin M, et al. Frequent MYC coamplification and DNA hypomethylation of multiple genes on 8q in 8p11-p12-amplified breast carcinomas. Oncogenesis. 2014;3:e95. 12. Souchek JJ, Baine MJ, Lin C, Rachagani S, Gupta S, Kaur S, et al. Unbiased analysis of pancreatic cancer radiation resistance reveals cholesterol biosynthesis as a novel target for radiosensitisation. Br J Cancer. 2014;111(6):1139–49. 13. Harada T, Chelala C, Crnogorac-Jurcevic T, Lemoine NR. Genomewide analysis of pancreatic cancer using microarray-based techniques. Pancreatology. 2009;9(1–2):13–24. 14. Yuen HF, McCrudden CM, Huang YH, Tham JM, Zhang X, Zeng Q, et al. TAZ expression as a prognostic indicator in colorectal cancer. PLoS One. 2013;8(1):e54211. 15. Liu Y, Sun W, Zhang K, Zheng H, Ma Y, Lin D, et al. Identification of genes differentially expressed in human primary lung squamous cell carcinoma. Lung Cancer. 2007;56(3):307–17. 16. Merrell MA, Wakchoure S, Lehenkari PP, Harris KW, Selander KS. Inhibition of the mevalonate pathway and activation of p38 MAP kinase are independently regulated by nitrogen-containing bisphosphonates in breast cancer cells. Eur J Pharmacol. 2007;570(1–3):27–37. 17. Journe F, Laurent G, Chaboteaux C, Nonclercq D, Durbecq V, Larsimont D, et al. Farnesol, a mevalonate pathway intermediate, stimulates MCF-7 breast cancer cell growth through farnesoid-Xreceptor-mediated estrogen receptor activation. Breast Cancer Res Treat. 2008;107(1):49–61. 18. Clendening JW, Pandyra A, Boutros PC, El Ghamrasni S, Khosravi F, Trentin GA, et al. Dysregulation of the mevalonate pathway promotes transformation. Proc Natl Acad Sci U S A. 2010;107(34): 15051–6. 19. Butt S, Butt T, Jirstrom K, Hartman L, Amini RM, Zhou W, et al. The target for statins, HMG-CoA reductase, is expressed in ductal carcinoma-in situ and may predict patient response to radiotherapy. Ann Surg Oncol. 2014;21(9):2911–9. 20. Vinayak S, Schwartz EJ, Jensen K, Lipson J, Alli E, McPherson L, et al. A clinical trial of lovastatin for modification of biomarkers associated with breast cancer risk. Breast Cancer Res Treat. 2013;142(2):389–98. 21. Alcaino J, Romero I, Niklitschek M, Sepulveda D, Rojas MC, Baeza M, et al. Functional characterization of the Xanthophyllomyces dendrorhous farnesyl pyrophosphate synthase and geranylgeranyl pyrophosphate synthase encoding genes that are involved in the synthesis of isoprenoid precursors. PLoS One. 2014;9(5):e96626. 22. Koyama T, Matsubara M, Ogura K. Isoprenoid enzyme systems of silkworm. I. Partial purification of isopentenyl pyrophosphate isomerase, farnesyl pyrophosphate synthetase, and geranylgeranyl pyrophosphate synthetase. J Biochem. 1985;98(2):449–56. 23. Miltiadous G, Saougos V, Cariolou M, Elisaf MS. Plasma lipoprotein(a) levels and LDL-cholesterol lowering response to statin therapy in patients with heterozygous familial hypercholesterolemia. Ann Clin Lab Sci. 2006;36(3):353–5. 24. Himbergen TM, van Tits LJ, Voorbij HA, de Graaf J, Stalenhoef AF, Roest M. The effect of statin therapy on plasma high-density lipoprotein cholesterol levels is modified by paraoxonase-1 in patients with familial hypercholesterolaemia. J Intern Med. 2005;258(5):442–9. 25. Sawada M, Matsuo M, Hagihara H, Tenda N, Nagayoshi A, Okumura H, et al. Effect of FR194738, a potent inhibitor of squalene epoxidase, on cholesterol metabolism in HepG2 cells. Eur J Pharmacol. 2001;431(1):11–6.