Cell Biochem Biophys (2012) 62:47–54 DOI 10.1007/s12013-011-9257-6

ORIGINAL PAPER

Studies on the Expression Patterns of Class I PI3K Catalytic Subunits and Its Prognostic Significance in Colorectal Cancer Binbin Cui • Ji Tao • Yanmei Yang

Published online: 11 September 2011 Ó Springer Science+Business Media, LLC 2011

Abstract The phosphatidylinositol 3-kinase/AKT (PI3K/ AKT) pathway plays a critical role in human cancer. We determined the expression patterns of class I PI3K catalytic subunits and evaluated their importance in the development or progression of colorectal cancer (CRC). For this purpose, expression of class I PI3K isoforms was evaluated in 82 primary CRC and paired non-cancerous mucosa samples by qRT-PCR. P-AKT-Ser473 and P-AKT-Thr308 expression were measured by western blot. We found that, compared with paired non-cancerous mucosa samples, mRNA expression of p110a and p110b in CRCs was significantly increased to 2.02-fold (95% confidence interval [CI] 1.25– 3.28 fold) and 1.76-fold (95% CI 1.19–2.60 fold), respectively; while slight differences were found regarding the expression of p110d (0.57-fold; 95% CI 0.31–1.07 fold) and p110c (0.97-fold; 95% CI 0.50–1.88 fold). Increased p110a and p110b expression correlated with primary tumor size, regional lymph node metastases, and AJCC stage. Increased p110b expression also correlated with distant metastasis. P-AKT-Thr308 and P-AKT-Ser473 expression showed significant direct correlations with p110a and p110b mRNA

Binbin Cui and Ji Tao have contributed equally to this work as co-first authors. B. Cui Department of Colorectal Surgery, The Affiliated 3rd Hospital, Harbin Medical University, Harbin, People’s Republic of China J. Tao Department of Medical Oncology, The Affiliated 3rd Hospital, Harbin Medical University, Harbin, People’s Republic of China Y. Yang (&) Cancer Research Institute, Harbin Medical University, Harbin 150081, People’s Republic of China e-mail: [email protected]

expression. Besides, CRC patients with p110b mRNA overexpression had a worse disease-free survival after radical surgery compared with those with normal or decreased levels (P = 0.043). It was, therefore, concluded that the altered p110a and p110b expression might contribute to the CRC development or progression. Keywords

PI3K
AKT
Colorectal cancer

Introduction Colorectal cancer (CRC) is the third most common malignant neoplasm diagnosed worldwide and the second leading cause of cancer-related deaths in men and women in the USA [1]. Despite recent advances in early detection, screening, and treatment regimens, there has been only a modest improvement in survival of the patients with advanced CRC [2, 3]. A better understanding of the underlying mechanisms regulating growth and progression of CRCs will facilitate the development of effective primary and secondary strategies to reduce the CRC-associated morbidity and mortality. The dysregulation of signal transduction pathways which are involved in cell survival, proliferation, and migration has been found in many human cancers [4]. Phosphoinositide 3-kinase (PI3K)/AKT is one of the most commonly activated signaling pathways in human cancers [5, 6]. As downstream effectors of receptor tyrosine kinases (RTKs), G protein-coupled receptors (GPCRs) and certain oncogenes such as small G protein RAS, PI3Ks transduces extracellular signals into intracellular messages by generating lipid second messengers which activate the serine–threonine protein kinase AKT (also known as protein kinase B, PKB) and many other downstream effectors [7, 8]. The aberrant

123

48

activation of PI3K/AKT signaling confers enhanced capacities for growth, proliferation, resistance to apoptosis, and migration of cancer cells while the inhibition of this pathway should provide a therapeutic approach for cancer thereby [9, 10]. PI3K proteins form a family that is divided into class I, II, and III according to their structural characteristics and lipid substrate preference [11, 12]. Class I PI3K is the most studied among these members [13]. They are heterodimers consisting of a catalytic subunit p110 and its associated regulatory subunit. There are four known p110 isoforms: p110a, p110b, p110c, and p110d, encoded by PIK3CA, PIK3CB, PIK3CG, and PIK3CD, respectively [14]. The p110a, p110b, and p110d constitutively bind to the regulatory subunit p85 whereas p110c binds the regulatory subunit p101 [6]. Class I PI3Ks produce the PIP3 lipid messengers in response to a variety of extracellular signals through RTKs (p110a, p110d) and GPCRs (p110b and p110c). Moreover, they are effectors of RAS, and are thus involved in several RAS-dependent signaling events including cell transformation and survival [15, 16]. Therefore, class I PI3Ks will be most important in regulating cell proliferation and in tumorigenesis [6]. Class I PI3Ks have different non-redundant cellular functions [16, 17] and their patterns of expression are differential: ubiquitous for p110a and p110b isoforms; and predominately in leukocytes for p110c and p110d [18]. Wild-type p110a is not oncogenic but it can be activated by genetic changes including point mutations, gene amplification, over expression, and rearrangement [6]. Cancer-specific mutations of p110a are frequently present in tumors such as breast and CRC and have been associated with poor prognosis of CRC [19, 20]. No such cancer-specific mutations have been identified in other three isoforms but there is evidence that they are also involved in carcinogenesis [21, 22]. Unlike wild-type p110a, other class I PI3K isoforms are oncogenic [23, 24]. Hence, their oncogenic potential maybe activated by differential expression [25]. In CRC, PIK3CA gene has been a target for much scrutiny because of the high mutation rate of about 15% [8], but the data on expression patterns of class I PI3K catalytic subunits are still scarce. Therefore, in this study, we determined the mRNA expression levels of four catalytic subunits of class I PI3Ks in CRC patient tissues and also evaluated the importance of these subunits in CRC development and or progression.

Materials and Methods Patients and Clinical Samples Between March 2006 and November 2007, 82 patients with CRC were recruited from the Affiliated Tumor Hospital of

123

Cell Biochem Biophys (2012) 62:47–54

Harbin Medical University, Harbin, China. The specimens including carcinoma and paired non-cancerous mucosa were snap frozen into liquid nitrogen and then stored at -80°C until later use. Non-cancerous mucosa was taken at least 5 cm away from the edge of primary carcinoma. Primary cancers were evaluated by two independent pathologists in accordance with the American Joint Committee on Cancer (AJCC; 6th Ed.) staging system. No patient received chemotherapy and or radiotherapy before surgery. Cases were followed up for a median time period of 36 months (range 6.20–43.03 months). This study was approved by the Research Ethics Committee of our hospital and all clinical samples were collected following written informed consent of the patients. Quantitative RT-PCR Total RNA was extracted from frozen tissue specimens using TRIzol reagent (Invitrogen, Carlsbad, CA) and following the manufacturer’s recommendations. Subsequently, firststrand cDNA was synthesized from total RNA (2 lg) using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Specific primers for PCR were designed using Primer 5.0 software and synthesized by TaKaRa (Dalian, China). All PCR primer sequences are shown in Table 1. Synthesized cDNA was mixed with SYBR Green Master Mix (Roche, Mannheim, Germany) and various sets of gene-specific primers, and quantitative PCR were performed using an ABI-Prism 7000 (Applied Biosystems, Foster City, CA) thermal cycler. The thermal cycling conditions for all genes were initiated with denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. At the end of the PCR cycles, melting curve analyzes were immediately run to validate the generation of expected, specific PCR product. The expression level of each gene was normalized to that of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The relative mRNA expression levels in CRC were calculated using the comparative threshold cycle (Ct) method. Western Blotting Frozen tissues samples were lysed in cell lysis buffer for Western and IP (Beyotime, Haimen, China) and complete protease inhibitor cocktail (Roche, Mannheim, Germany). Protein concentrations were measured by using Bradford method (Sigma, St. Louis, USA). Equal amounts (30 lg/ lane) of sample proteins were separated using 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDSPAGE) and transferred to nitrocellulose membranes (Millipore Co., Bedford, MA, USA). After blocking with 1% bovine serum albumin (BSA) for 1 h at room temperature

Cell Biochem Biophys (2012) 62:47–54 Table 1 Primer sequences for real-time RT-PCR analysis.

Gene PI3KCA PI3KCB PI3KCD PI3KCG GAPDH

49

Primer

Sequence

Amplicon length (bp)

PI3KCA (F)

GGAAGAGCCCCGAGCGTT

113

PI3KCA (R)

CTGATGATGGTCGTGGAG

PI3KCB (F)

AAGAATACAACTCTGGGG

PI3KCB (R)

CTATGTCTGTCACCAATC

PI3KCD (F)

GCGGATGAAGCTGGTGGT

PI3KCD (R)

GGGCAGGTCGCAGATGTT

PI3KCG (F)

AGAAGGGAAGTCTGGGATC

PI3KCG (R)

TTCACAGCCTGGACCAAT

GAPDH (F)

ACGGATTTGGTCGTATTGGG

GAPDH (R)

TGATTTTGGAGGGATCTCGC

(RT), the membranes were incubated for 2 h at RT in primary antibodies for b-actin (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and for AKT, p-AKT-S473, and p-AKT-T308 (Cell Signaling, Beverly, MA, USA) followed by incubation for 1 h with alkaline phosphatase-conjugated goat anti-rabbit secondary antibody (Promega, Madison, WI, USA). The positive bands representing specific proteins were visualized using Western Blue Stabilized Substrate for Alkaline Phosphatase (Promega, Madison, WI, USA). Data Analysis The ratios of gene expression were found to be not normally distributed (Shapiro–Wilk test). The gene distribution was thus established by using log10 and the geometric means were compared. Correlation between levels of gene expression was evaluated by Pearson’s coefficient. Correlation between gene expression ratios and clinical pathologic variables in tissue samples was analyzed by ANOVA test. Disease-free survival (DFS) rates were plotted using Kaplan–Meier method and statistical differences were analyzed with log–rank test. Associations of patient and tumor variables with disease-free survival times were assessed by using Cox proportional hazards models. Statistical analysis was performed using version 13.0 of SPSS package and two-tailed P \ 0.05 values were considered statistically significant.

109 145 167 260

2.02-fold (95% confidence interval [CI] 1.25–3.28 fold) and 1.76-fold (95% CI 1.19–2.60 fold), respectively; while no obvious differences were found in mRNA expression levels of p110d (0.57-fold; 95% CI 0.31–1.07 fold) and p110c (0.97-fold; 95% CI 0.50–1.88 fold). In addition, altered expression of p110a, p110b, p110d, and p110c was arbitrarily considered in tumor tissues when the expression showed a 2-fold increase or decrease compared with paired non-cancerous mucosa samples. We found that the overexpression frequency for p110a, and p110b was 54.9 and 56.1%, respectively; while the frequency of decreased expression for p110d and p110c was 47.6 and 40.2%, respectively (Table 2).

Association Between Class I PI3K Catalytic Subunits and Clinico-pathological Variables The importance of class I PI3K catalytic subunits in CRC was further evaluated by correlating their expression with clinico-pathological features. Several of the analyzed variables showed significant associations with the mRNA expression levels (Table 3; Fig. 1). In our CRC cases, increased expression of p110a and p110b correlated with primary tumor size, regional lymph node metastases, and AJCC stage. Moreover, tumors with high p110b expression also correlated with distant metastasis. In contrast, no correlation was found between p110d and p110c expression and these variables.

Results Expression of Class I PI3K Catalytic Subunits in CRCs To gain insight into the expression patterns of class I PI3K catalytic subunits in CRCs, a total of 82 primary CRC cases were evaluated by quantitative reverse transcription (RT)-PCR. Compared with paired non-cancerous mucosal tissue samples, mRNA expression levels of p110a and p110b in primary CRCs were significantly increased up to

Association Between Class I PI3K Catalytic Subunits and p-AKT To determine the relationship between class I PI3K catalytic subunits expression and AKT activation, the levels of P-AKT-Ser473 and P-AKT-Thr308 were measured by western blot (Fig. 2). In our CRC tissue samples, the expression of P-AKT-Thr308 and P-AKT-Ser473 showed

123

50

Cell Biochem Biophys (2012) 62:47–54

Table 2 Frequencies of altered expression of class I PI3K catalytic subunits in CRC patients. Decreased expression

Normal expression

Overexpression

Frequency

Percentage

Frequency

Percentage

Frequency

Percentage

p110a

23

28.0

14

17.1

45

54.9

p110b

23

28.0

13

15.9

46

56.1

p110d

39

47.6

16

19.5

27

32.9

p110c

33

40.2

19

23.2

30

36.6

Table 3 Correlations between expression levels and clinico-pathological variables. Variable

N

p110a GA

a

p110b P

p110d

GA

P

2.076

0.439

p110c

GA

P

0.762

0.406

GA

P

0.698

0.351

Sex Male

38

3.043

Female Location

44

1.423

0.118

Colon

27

3.375

Rectum

55

1.575

\5

51

2.734

C5

31

2.024

Well

36

2.158

Moderate

31

1.844

2.443

0.435

1.097

Poor

15

2.104

1.671

0.763

1.427

T1, T2, T3

29

0.614

T4

53

3.889

49 33

1.188 2.024

0.007

M0

70

1.801

0.139

M1

12

3.997

I

18

0.377

II

28

1.956

1.204

1.054

0.643

III

23

5.232

2.222

0.402

1.644

IV

13

4.158

7.354

1.130

1.605

1.527 0.14

1.773

0.449 0.980

1.755

0.941

1.301 0.274

0.450

0.881

0.831

1.024

Tumor size (cm) 0.336

2.170

0.411

1.761

0.779

0.452

0.574

1.016

0.922

0.975

Differentiation 0.956

1.357

0.406

0.646

0.782

0.751

0.759

pTb \0.001

0.964

0.023

2.448

0.335

0.198

0.769

0.538

0.186

1.348

pNc N0 N1

1.185 1.761

0.013

1.379

0.002

0.633 0.574

0.705

0.507

0.35

0.529 0.975

0.054

0.867

0.396

pMd 7.332

1.175

1.930

AJCCe

a

pT represents primary tumor

c

pN represents regional lymph nodes pM represents distant metastasis

e

0.841

0.003

0.215

0.214

0.666

0.603

GA represents geometrical average or geomean

b

d

0.001

AJCC represents American Joint Committee on Cancer

significant direct correlations with mRNA expression of p110a and p110b. The highest Pearson’s coefficients were obtained for the correlation between p110a and P-AKTThr308 (r = 0.333, P = 0.003) and between p110a and

123

P-AKT-Ser473 (r = 0.324, P = 0.003). Expression of p110b also correlated with P-AKT-Thr308 (r = 0.277, P = 0.013) and P-AKT-Ser473 (r = 0.303, P = 0.006). However, p110d expression had non-significant correlation

Cell Biochem Biophys (2012) 62:47–54

Fig. 1 Association between expression levels of class I PI3K catalytic subunits and clinico-pathological features. The association between class I PI3K catalytic subunits p110a and p110b (log10 of mRNA expression; X-axis) and CRC clinico-pathological features such as primary tumor, regional lymph node or distant metastases,

51

and AJCC staging (Y-axis) is shown. Logarithm of PIKCA expression is shown against a primary tumor, b regional lymph node metastases, and c AJCC staging. Similarly, logarithm of PIKCB expression is shown against d primary tumor, e regional lymph node metastases, f distant metastasis, and g AJCC staging

with P-AKT-Thr308 (r = 0.200, P = 0.060) and P-AKTSer473 (r = 0.184, P = 0.103) whereas no correlation was found between AKT activation and p110c expression. Association Between Class I PI3K Catalytic Subunits and Therapy Outcome Twenty-nine (35%) of the 82 patients relapsed or died within 3 years of radical surgery. To assess the prognostic value of class I PI3K catalytic subunits, we performed a survival analysis using Kaplan–Meier method and log–rank test to compare the survival curves. There was no difference in 3-year DFS for p110a, p110d, and p110c expression (Fig. 3 a, c, and d, respectively). However, CRC patients with p110b mRNA overexpression had a worse DFS after radical surgery as compared to those with normal or decreased expression levels (P = 0.043, Fig. 3b). The univariate Cox regression analysis revealed that only p110b mRNA expression was a significant predictor of the 3-year DFS (P = 0.023). However, in the multivariate analysis with models including primary tumor, regional lymph node metastases, distant metastases, and AJCC stage, p110b was not an independent predictor of the 3-year DFS.

Discussion The previous studies have shown that PI3K signaling pathway is a pivotal signal transduction network that mediates multiple

Fig. 2 Expression of P-AKT-Thr308 and P-AKT-Ser473. The expression levels of p-AKT-Ser473 and p-AKT-Thr308 in primary CRCs were analyzed by Western blot as described in the ‘‘Materials and methods’’ section. The lanes marked as C and N represent samples from primary CRC and paired non-cancerous adjacent tissues, respectively

cellular activities such as cell survival, proliferation, and differentiation, and is frequently deregulated by diverse mechanisms in human cancer [26, 27]. Therefore, PI3K targeting may represent an attractive approach to combat cancer proliferation in vivo. In this regard, recent studies [16, 17] have reported that different PI3K members have distinct, nonredundant cellular functions in cell signaling and tumorigenesis, e.g., p110a is required to sustain the proliferation of PIK3CA-mutant tumors while p110b is implicated in PTENdeficient tumorigenesis [28]. As though p110c and p110d expression is predominantly restricted to leukocytes, different human cancer cell lines were also shown to express these PI3K isoforms, and the aberrant expression of p110d was shown to contribute to neuroblastoma cell growth and survival [29]. Therefore, it is crucial to characterize the expression patterns of PI3K isoforms in tumors to evaluate their significance in

123

52

Cell Biochem Biophys (2012) 62:47–54

Fig. 3 Kaplan–Meier disease-free survival (DFS) regarding mRNA expression levels of class I PI3K catalytic subunits. The data show no association between the DFS and a p110a, c p110d, and d p110c

mRNA expression; whereas b the overexpression of p110b mRNA has an association with a worse DFS

cancer development and or progression. The involvement of PI3Ks in tumorigenesis of CRC has been verified, however, most studies involving class I PI3Ks focused on activating mutations only in p110a [8]. Therefore, we investigated the expression patterns of class I PI3Ks multiple catalytic subunits and evaluated their possible involvement in the development and or progression of primary CRC. The importance of p110a in CRCs is highlighted by the high frequency of oncogenic transformation-inducing activating mutations in PIK3CA which has important clinical implications for the disease diagnosis, prognosis, and therapy [30, 31]. It was shown that an increase in PI3K activity was due to a higher p110a and p110b expression in human colon tumor biopsies and adenocarcinoma cells

[25]. Using immunohistochemical staining, PIK3CA overexpression frequency in 58 hereditary nonpolyposis colorectal cancers (HNPCC) was found to be 59% [32]. Similarly, in our CRC patients, the expression levels of p110a mRNA were increased significantly up to 2.02-fold (95% CI 1.25–3.28 fold), and overexpression frequency was 54.9%. Moreover, the putative relationship between p110a and CRC was further corroborated by its association with the primary tumor, lymph node involvement, and tumor AJCC grade. In addition, p110a mRNA expression correlated directly with p-AKT-Thr308 (r = 0.333) and P-AKT-Ser473 (r = 0.324) suggesting that p110a may induce CRC carcinogenesis via activating the AKT which is supported by the previous study [33].

123

Cell Biochem Biophys (2012) 62:47–54

Although PIK3CB mutations corresponding to oncogenic PIK3CA mutations fail to render the transforming activity in human cells, p110b has attracted attention to its oncogenic potential because wild-type or a constitutively activated PIK3CB can contribute oncogenic phenotype in model systems [24, 34]. Of note, our data also elucidate the role played by p110b in CRC. To this end, in 82 CRC cases studied, p110b mRNA expression levels were found to be significantly increased up to 1.76-fold (95% CI 1.19–2.60 fold) and overexpression frequency was 56.1%. Moreover, the increased p110b mRNA expression was found to be associated with certain clinico-pathological parameters such as primary tumor, lymph node involvement, presence of metastasis in distant organs, and advancing AJCC stage. Like p110a, p110b mRNA expression also correlated positively with the P-AKT-Thr308 (r = 0.277, P = 0.013) and P-AKT-Ser473 (r = 0.303, P = 0.006). These findings suggest a link between p110b and CRC pathogenesis. Besides, p110b mRNA overexpression associated with a significantly worse DFS. As well, a previous study [35] found that loss of PTEN expression and AKT activation might play an important role in sporadic colon carcinogenesis, whereas the PTEN loss was an independent predictor of local recurrence in colorectal cancers. It has been also suggested that p110b plays a critical role in PI3K pathway activation, cell growth, and survival in PTENdeficient cancer cell lines [28]. Taken together, both p110b and PTEN loss may play an important role in CRC pathogenesis. In contrast to p110a and p110b whose genetic inactivation in mice leads to an early embryonic lethality [36, 37], p110c and p110d knockout mice are viable but show defective immune responses [38, 39]. Thus, p110c and p110d have been identified as PI3K signaling mediators in the immune system. The p110d overexpression was observed in acute myeloblastic leukemia [21], and that of p110c was observed in chronic myeloid leukemia [22], while it is still unclear how they are implicated in CRC carcinogenesis. Interestingly, on one hand, loss of p110c expression was observed in colon cancer cell lines and colorectal adenocarcinoma tissue samples [40, 41]; and on the other hand, p110c overexpression in human colon carcinoma cells reduced their growth in a xenograft tumor model [40]. Therefore, it may be suggested that p110c plays a tumor-suppressive role. This argument is supported by the findings of a pervious study [40] showing that mice lacking in p110c expression have an increased incidence of colorectal carcinomas. However, none of the p110c-null mice were reported by others to develop tumors [42]. Hence, it remains controversial that the loss of functional p110c leads directly to the transformation of colon epithelial cells and tumor progression. This conflicting evidence allowed us to further study p110c and p110d

53

expression in CRC patients. In this regard, no obvious differences were found in the expression of p110d (0.57fold, 95% CI 0.31–1.07 fold) and p110c (0.97-fold, 95% CI 0.50–1.88 fold), though the rate of low expression for p110d and p110c was 47.6 and 40.2%, respectively. Importantly, their expression had no correlation with the AKT activation which has been found to be significantly elevated in CRC. It can be, therefore, suggested that p110d and p110c have no effect on CRC carcinogenesis. Nonetheless, PIK3CA genetic alterations and PTEN abrogation have been reported to contribute to the activation of AKT [35], which suggests that AKT can be activated through different mechanisms. Therefore, further in-depth analysis of these different mechanisms will be required to clearly understand the causes of AKT activation in CRC. In summary, our study provides the evidence that p110a and p110b may play an important role in CRC carcinogenesis, further suggesting that p110a and p110b maybe exploited as potential drug targets for CRC. Further research will be required to validate effects of p110a or p110b specific inhibitors on CRC. Acknowledgments The authors thank the Natural Science Foundation of Heilongjiang Province (Grant # D2007-79), NSFC (30972561), Heilongjiang Postdoctoral Science-Research Foundation and Scientific Research Fund of Heilongjiang Provincial Education Department (Grant # 11541129) for financial support.

References 1. Jemal, A., Siegel, R., Ward, E., Hao, Y., Xu, J., & Thun, M. J. (2009). Cancer statistics 2009. CA: A Cancer Journal for Clinicians, 59, 225–249. 2. Moertel, C. G., Fleming, T. R., Macdonald, J. S., et al. (1990). Levamisole and fluorouracil for adjuvant therapy of resected colon carcinoma. The New England Journal of Medicine, 322, 352–358. 3. Krook, J. E., Moertel, C. G., Gunderson, L. L., et al. (1991). Effective surgical adjuvant therapy for high-risk rectal carcinoma. The New England Journal of Medicine, 324, 709–715. 4. Hahn, W. C., & Weinberg, R. A. (2002). Rules for making human tumor cells. The New England Journal of Medicine, 347, 1593– 1603. 5. Niedermeier, M., Hennessy, B. T., Knight, Z. A., et al. (2009). Isoform-selective phosphoinositide 3’-kinase inhibitors inhibit CXCR4 signaling and overcome stromal cell-mediated drug resistance in chronic lymphocytic leukemia: a novel therapeutic approach. Blood, 113, 5549–5557. 6. Bader, A. G., Kang, S., Zhao, L., & Vogt, P. K. (2005). Oncogenic PI3K deregulates transcription and translation. Nature Review Cancer, 5, 921–929. 7. Carracedo, A., & Pandolfi, P. P. (2008). The PTEN-PI3K pathway of feedbacks and cross-talks. Oncogene, 27, 5527–5541. 8. Liu, P., Cheng, H., Roberts, T. M., & Zhao, J. J. (2009). Targeting the phosphoinositide 3-kinase pathway in cancer. Nature Review Drug Discovery, 8, 627–644. 9. Garcia-Echeverria, C., & Sellers, W. R. (2008). Drug discovery approaches targeting the PI3K/Akt pathway in cancer. Oncogene, 27, 5511–5526.

123

54 10. Chen, J. (2008). Is src the key to understanding metastasis and developing new treatments for colon cancer? Nature Clinical Practice Gastroenterology Hepatology, 5, 306–307. 11. Cantley, L. C. (2002). The phosphoinositide 3-kinase pathway. Science, 296, 1655–1657. 12. Wymann, M. P., Zvelebil, M., & Laffargue, M. (2003). Phosphoinositide 3-kinase signalling—which way to target? Trends in Pharmacological Sciences, 24, 366–376. 13. Edgar, K. A., Wallin, J. J., Berry, M., et al. (2010). Isoformspecific phosphoinositide 3-kinase inhibitors exert distinct effects in solid tumors. Cancer Research, 70, 1164–1172. 14. Vanhaesebroeck, B., Guillermet-Guibert, J., Graupera, M., & Bilanges, B. (2010). The emerging mechanisms of isoform-specific PI3K signalling. Nature Review Molecular Cell Biology, 11, 329–341. 15. Graupera, M., Guillermet-Guibert, J., Foukas, L. C., et al. (2008). Angiogenesis selectively requires the p110alpha isoform of PI3K to control endothelial cell migration. Nature, 453, 662–666. 16. Guillermet-Guibert, J., Bjorklof, K., Salpekar, A., et al. (2008). The p110beta isoform of phosphoinositide 3-kinase signals downstream of G protein-coupled receptors and is functionally redundant with p110gamma. Proceedings of the National Academy of Sciences of the United States of America, 105, 8292–8297. 17. Gilio, K., Munnix, I. C., Mangin, P., et al. (2009). Non-redundant roles of phosphoinositide 3-kinase isoforms alpha and beta in glycoprotein VI-induced platelet signaling and thrombus formation. The Journal of Biological Chemistry, 284, 33750–33762. 18. Ghigo, A., & Hirsch, E. (2008). Isoform selective phosphoinositide 3-kinase gamma and delta inhibitors and their therapeutic potential. Recent Patents on Inflammation & Allergy Drug Discovery, 2, 1–10. 19. Ogino, S., Nosho, K., Kirkner, G. J., et al. (2009). PIK3CA mutation is associated with poor prognosis among patients with curatively resected colon cancer. Journal of Clinical Oncology, 27, 1477–1484. 20. Barault, L., Veyrie, N., Jooste, V., et al. (2008). Mutations in the RAS-MAPK, PI(3)K (phosphatidylinositol-3-OH kinase) signaling network correlate with poor survival in a population-based series of colon cancers. International Journal of Cancer, 122, 2255–2259. 21. Sujobert, P., Bardet, V., Cornillet-Lefebvre, P., et al. (2005). Essential role for the p110delta isoform in phosphoinositide 3-kinase activation and cell proliferation in acute myeloid leukemia. Blood, 106, 1063–1066. 22. Hickey, F. B., & Cotter, T. G. (2006). BCR-ABL regulates phosphatidylinositol 3-kinase-p110gamma transcription and activation and is required for proliferation and drug resistance. The Journal of Biological Chemistry, 281, 2441–2450. 23. Mizoguchi, M., Nutt, C. L., Mohapatra, G., & Louis, D. N. (2004). Genetic alterations of phosphoinositide 3-kinase subunit genes in human glioblastomas. Brain Pathology, 14, 372–377. 24. Kang, S., Denley, A., Vanhaesebroeck, B., & Vogt, P. K. (2006). Oncogenic transformation induced by the p110beta, -gamma, and -delta isoforms of class I phosphoinositide 3-kinase. Proceedings of the National Academy of Sciences of the United States of America, 103, 1289–1294. 25. Be´nistant, C., Chapuis, H., & Roche, S. (2000). A specific function for phosphatidylinositol 3-kinase alpha (p85alphap110alpha) in cell survival and for phosphatidylinositol 3-kinase beta (p85alpha-p110beta) in de novo DNA synthesis of human colon carcinoma cells. Oncogene, 19, 5083–5090.

123

Cell Biochem Biophys (2012) 62:47–54 26. Yuan, T. L., & Cantley, L. C. (2008). PI3K pathway alterations in cancer: variations on a theme. Oncogene, 27, 5497–5510. 27. Martin-Berenjeno, I., & Vanhaesebroeck, B. (2009). PI3K regulatory subunits lose control in cancer. Cancer Cell, 16, 449–450. 28. Wee, S., Wiederschain, D., Maira, S. M., et al. (2008). PTENdeficient cancers depend on PIK3CB. Proceedings of the National Academy of Sciences of the United States of America, 105, 13057–13062. 29. Boller, D., Schramm, A., Doepfner, K. T., et al. (2008). Targeting the phosphoinositide 3-kinase isoform p110delta impairs growth and survival in neuroblastoma cells. Clinical Cancer Research, 14, 1172–1181. 30. Ikenoue, T., Kanai, F., Hikiba, Y., et al. (2005). Functional analysis of PIK3CA gene mutations in human colorectal cancer. Cancer Research, 65, 4562–4567. 31. Sartore-Bianchi, A., Martini, M., Molinari, F., et al. (2009). PIK3CA mutations in colorectal cancer are associated with clinical resistance to EGFR-targeted monoclonal antibodies. Cancer Research, 69, 1851–1857. 32. Ekstrand, A. I., Jo¨nsson, M., Lindblom, A., Borg, A., & Nilbert, M. (2010). Frequent alterations of the PI3K/AKT/mTOR pathways in hereditary nonpolyposis colorectal cancer. Familial Cancer, 9, 125–129. 33. Bader, A. G., Kang, S., & Vogt, P. K. (2006). Cancer-specific mutations in PIK3CA are oncogenic. Proceedings of the National Academy of Sciences of the United States of America, 103, 1475– 1479. 34. Zhao, J. J., Liu, Z., Wang, L., Shin, E., Loda, M. F., & Roberts, T. M. (2005). The oncogenic properties of mutant p110alpha and p110beta phosphatidylinositol 3-kinases in human mammary epithelial cells. Proceedings of the National Academy of Sciences of the United States of America, 102, 18443–18448. 35. Colakoglu, T., Yildirim, S., Kayaselcuk, F., et al. (2008). Clinicopathological significance of PTEN loss and the phosphoinositide 3-kinase/Akt pathway in sporadic colorectal neoplasms: Is PTEN loss predictor of local recurrence? American Journal of Surgery, 195, 719–725. 36. Bi, L., Okabe, I., Bernard, D. J., & Nussbaum, R. L. (2002). Early embryonic lethality in mice deficient in the p110beta catalytic subunit of PI 3-kinase. Mammalian Genome, 13, 169–172. 37. Bi, L., Okabe, I., Bernard, D. J., Wynshaw-Boris, A., & Nussbaum, R. L. (1999). Proliferative defect and embryonic lethality in mice homozygous for a deletion in the p110alpha subunit of phosphoinositide 3-kinase. The Journal of Biological Chemistry, 274, 10963–10968. 38. Ali, K., Bilancio, A., Thomas, M., et al. (2004). Essential role for the p110delta phosphoinositide 3-kinase in the allergic response. Nature, 431, 1007–1011. 39. Okkenhaug, K., Bilancio, A., Farjot, G., et al. (2002). Impaired B and T cell antigen receptor signaling in p110delta PI 3-kinase mutant mice. Science, 297, 1031–1034. 40. Sasaki, T., Irie-Sasaki, J., Horie, Y., et al. (2000). Colorectal carcinomas in mice lacking the catalytic subunit of PI(3)Kgamma. Nature, 406, 897–902. 41. Semba, S., Itoh, N., Ito, M., et al. (2002). Down-regulation of PIK3CG, a catalytic subunit of phosphatidylinositol 3-OH kinase, by CpG hypermethylation in human colorectal carcinoma. Clinical Cancer Research, 8, 3824–3831. 42. Barbier, M., Attoub, S., Calvez, R., et al. (2001). Tumour biology. Weakening link to colorectal cancer? Nature, 413, 796.