Tumor Biol. (2014) 35:10249–10257 DOI 10.1007/s13277-014-2344-8

RESEARCH ARTICLE

Upregulation of the long noncoding RNA HOTAIR predicts recurrence in stage Ta/T1 bladder cancer Ting-Hua Yan & Sui-Wan Lu & Yong-Qing Huang & Gan-Bo Que & Jun-Hui Chen & Yong-Ping Chen & Hong-Bin Zhang & Xing-Lan Liang & Jin-Hua Jiang

Received: 6 May 2014 / Accepted: 10 July 2014 / Published online: 17 July 2014 # International Society of Oncology and BioMarkers (ISOBM) 2014

Abstract Stage Ta/T1 urothelial carcinoma of the bladder (Ta/T1 BC) has a marked tendency to recurrence. Long noncoding RNA HOTAIR has been reported to be expressed in some human cancers such as breast cancer, and it may be positively correlated with patient’s prognosis. The aim of our study was to evaluate the prognostic value of HOTAIR in Ta/ T1 BC. HOTAIR expression in Ta/T1 BC tissues and adjacent normal tissues was collected from 110 patients and measured by real-time quantitative PCR. The relationships between HOTAIR and the clinical pathological characteristics of Ta/ T1 BC patients were analyzed. Immunohistochemistry was done to detect the protein of Wnt inhibitory factor 1 (WIF-1) as well. Ninety out of 110 specimens were detected in HOTAIR high expression. Histological grade and expression levels of HOTAIR were positively correlated with the recurrence rate. HOTAIR expression (hazard ratio 4.712; 95 % CI 2.894–8.714; P<0.001) was an independent predictor of recurrence rate in multivariate Cox regression analysis. HOTAIR expression is correlated with patients’ poor prognosis. A significant inverse correlation between HOTAIR and WIF-1 expression was demonstrated in Ta/T1 BC tissues. The expression levels of HOTAIR are an independent prognostic factor of recurrence in Ta/T1 BC patients. T.
Keywords HOTAIR . LncRNA . Bladder cancer . Wnt inhibitory factor 1

Introduction Bladder cancer is the most common genitourinary tumor in human populations, and it was estimated in 2013 that 72,570 new cases of cancer of the urinary bladder were diagnosed in the USA and 15,210 deaths were attributable to bladder cancer [1]. Urothelial carcinoma of the bladder is the most common histological subtype of bladder cancer. Overall, 70 % of patients present with nonmuscle invasive bladder cancer (i.e., pTa and pT1), and more than 70 % of them develop recurrences, of whom 15 % progress to cancers that invade the muscular layer [2]. Clinically, radical cystectomy remains the most common treatment for patients with muscle-invasive bladder cancer or for patients with superficial disease that is at high risk of recurrence and progression [3]. Despite advances in surgical technique and an improved understanding of the role of pelvic lymphadenectomy, the 5-year cancer-specific survival remains at only 50–60 % [4]. Long noncoding RNAs (LncRNAs) are a new class of transcripts recently discovered to be pervasively transcribed in the genome and are critical regulators of the epigenome [5, 6]. As with microRNAs, LncRNAs may be useful in predicting tumor prognosis and in regulating tumorigenesis [7]. As a result, LncRNAs have gained attention worldwide. HOTAIR, a widely focused LncRNA, was initially proposed to be involved in primary breast cancer and colorectal cancers [8, 9]. HOTAIR is increased in expression in primary breast tumors and metastases, and HOTAIR expression level in primary tumors is a powerful predictor of eventual metastasis and death. Enforced expression of HOTAIR in epithelial cancer cells induced genome-wide retargeting of Polycomb repressive complex 2 (PRC2) to an occupancy pattern more

10250

resembling embryonic fibroblasts, leading to altered histone H3 lysine 27 methylation (H3K27), gene expression, and increased cancer invasiveness and metastasis in a manner dependent on PRC2 [10]. Clinical studies demonstrated that HOTAIR overexpression is a potential candidate biomarker for predicting tumor recurrence in hepatocellular carcinoma patients who have undergone liver transplant therapy and may be a potential therapeutic target [11]. Furthermore, frequent HOTAIR upregulation was discovered to be associated with the malignant behavior of gastrointestinal stromal tumors [12]. However, few studies have examined in detail the molecular mechanisms of HOTAIR in bladder cancer. The Wnt/β-catenin signaling pathway is an evolutionarily conserved pathway required for adult tissue maintenance in the bone, heart, muscle, and other tissues [13]. Common epigenetic alterations include DNA hypermethylation in the promoter region of APC, Axin2, SFRPs, Wnt inhibitory factor 1 (WIF-1), etc. [14]. WIF-1 is the key inhibitor of the Wnt/βcatenin signaling pathway, which binds directly to extracellular Wnt ligands, preventing their interaction with the receptors and leading to degradation of cytosolic β-catenin by the APC/ Axin1 destruction complex [15]. The epigenetic regulator of WIF-1 and the regulatory mechanism is poorly understood. The present study was to evaluate the value of HOTAIR in predicting recurrence after initial treatment in Ta/T1 urothelial carcinoma of the bladder (Ta/T1 BC) and to preliminarily analyze the regulatory mode between HOTAIR and WIF-1.

Methods Patients and surgical specimens Patient data were accessed from the databank of the Department of Pathology of Second Hospital of Longyan City (Fujian, China). One hundred ten consecutive patients (80 male and 30 female) with initial Ta/T1 BC and who underwent transurethral resection of the bladder from 2006 to 2009 were included in the study. Cancer tissues were collected from the patients after obtaining informed consent, which was in accordance with the institutional guidelines of the Second Hospital of Longyan City. Parts of specimens were stored in liquid nitrogen and the others fixed in formalin and embedded in paraffin. Clinical charts were reviewed, and follow-up data were collected. All slides were reviewed by one uropathologist. Tumor stage and grade were assigned according to the TNM (UICC, 2002) and WHO classification of malignant tumors of the urinary tract [16, 17]. Patients were only included in the study if they had provided written consent to participate in the study after receiving oral and written information regarding its course and purpose. Approval for the study was received from the Ethics Committee of the host institution.

Tumor Biol. (2014) 35:10249–10257

Cell lines The SV-40-immortalized human uroepithelial cell line SVHUC-1 and human BC cell lines T24, J82, and BIU-87 were obtained from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (CCCAS, China). SV-HUC-1 cells were cultured in Ham’s F-12 (Sigma) medium with 10 % fetal bovine serum (Gibco), the BC cell lines were cultured in RPMI-1640 medium (HyClone) with 10 % fetal bovine serum (Gibco), 50 U/ml of penicillin and 50 μg/ml of streptomycin. All cells were cultured in a sterile incubator maintained at 37 °C with 5 % CO2. Transfection of siRNA Small interfering RNA (siRNA) oligonucleotides targeting HOTAIR (si-HOTAIR, 50 nM) were transfected into T24 cells, respectively, using Lipofectamine RNAiMAX (Invitrogen), according to the manufacturer’s instruction. Target genes expression levels were measured 48 h post-transfection. The corresponding assays were then performed. The target sequence of si-HOTAIR was 5′-AAAUCCAGAACCCUCU GACAUUUGC-3′. HOTAIR expression retrovirus vector and stable cell lines To construct the HOTAIR expression retrovirus vector, fulllength HOTAIR was amplified by PCR and cloned into the pBABE retroviral vector using the primers 5′-GACTCGCC TGTGCTCTGGAGCT-3′ and 5′-TTGAAAATGCATCCAG ATTTTT-3′. The retrovirus was produced by transient transfection in HEK293T cells. The T24 cells were infected with the virus in the presence of 10 μg/ml polybrene (Sigma). The supernatant was removed after 24 h and replaced with complete culture medium containing 1 g/ml puromycin. In vitro cell invasion assays To determine cell invasion, T24 cells were examined in transwell chambers with members coated with Matrigel (Costar). For this purpose, 1×105 cells transfected with siRNAs targeting HOTAIR (si-HOTAIR) or a scrambled negative control (si-NC) were suspended in 200 μl serumfree RPMI-1640 medium and seeded on the upper chamber; the lower chamber was filled with 10 % fetal bovine serum as the chemoattractant. After 48 h, cells on the upper side of the membrane were wiped off, and cells on the lower side of the membrane were fixed and stained with crystal violet solution. The cells under the microscopic fields in each chamber were photographed and counted, and values were expressed as fold induction. All invasion assays were done in triplicate for at least three independent experiments.

Tumor Biol. (2014) 35:10249–10257

10251

Scratch wound assay

Immunohistochemistry staining

T24 cells were transfected with either 50-nM si-HOTAIR or si-NC. When cell confluence reached approximately 80 % at 24 h post-transfection, wounds were created in confluent cells using a 10-μl pipette tip. Cells were then rinsed with medium to remove any free-floating cells and debris. Medium was added, and culture plates were incubated at 37 °C. Wound healing was observed at different time points within the scrape line, and representative scrape lines were photographed. Duplicate wells for each condition were examined, and each experiment was repeated in triplicate.

Paraffin sections (4 μm thick) were deparaffinized in xylene and rehydrated in grade alcohol, followed by boiling in 10 mmol/l of citrate buffer (pH 6.0) for antigen retrieval. After inhibition of endogenous peroxidase activities for 30 min with methanol containing 0.3 % H2O2, the sections were blocked with 2 % bovine serum albumin for 30 min and incubated overnight at 4 °C with primary monoclonal antibody (1:200; Abcam). After washing thrice with PBS, the slides were incubated with HRP polymer-conjugated antirabbit secondary antibody for 30 min, followed by reaction with diaminobenzidine and counterstaining with Mayer’s hematoxylin. Negative control was done by omission of the primary antibody and substituting it with nonspecific rabbit IgG.

Real-time quantitative PCR assay Total RNA was isolated tissue using TRIzol reagent according to the manufacturer’s protocol (Invitrogen). RNA was reverse transcribed using SuperScript First Strand complementary DNA (cDNA) System (Invitrogen) according to the manufacturer’s instructions. The PCR amplification was performed for 40 cycles at 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s, on an Applied Biosystems 7900HT (Applied Biosystems) with 1.0 μl of cDNA and SYBR Green Real-time PCR Master Mix (Takara). Data was collected and analyzed by SDS2.3 Software (Applied Biosystems). The expression level of each candidate gene was internally normalized against that of the GAPDH. The relative quantitative value was expressed by the 2−ΔΔCt method. Each experiment was performed in triplicates and repeated three times.

Western blot assay Cells were lysed in lysis buffer containing protease inhibitor cocktail. Protein concentration was determined using a BioRad protein assay system (Bio-Rad). Equivalent amounts of proteins were separated by SDS-PAGE and then transferred to polyvinylidene difluoride membranes (Bio-Rad). After being blocked in Tris-buffered saline (TBS) containing 5 % nonfat milk, the membranes were incubated with primary antibodies (1:500, Abcam), β-actin (1:1000, Abcam) at 4 °C for 12 h, and then with secondary antibody conjugated to horseradish peroxidase at room temperature for 2 h. ECL detection reagent (Amersham Life Science) was used to demonstrate the results.

Chromatin immunoprecipitation (CHIP) A CHIP assay was conducted using EZ-ChIPTM (17-371, Millipore), according to the manufacturer’s instruction. Retrieved DNA was detected by PCR reaction. The primers for the WIF-1 promoter region are listed in Table 5.

Evaluation of immunohistochemical staining Two independent observers blinded to the clinical information performed the immunoreactivity score (IRS) for WIF-1 expression. The staining results were scored based on the following criteria: (i) percentage of positive tumor cells in the tumor tissue, 1 (<25 %), 2 (26–50 %), 3 (51–75 %), and 4 (76–100 %); and (ii) signal intensity, 0 (negative), 1 (weak), 2 (moderate), and 3 (marked). The IRS was calculated by multiplying the score for the percentage of positive cells by the intensity score (range, 0–12). The average IRS for each case was assigned as the staining result for the patient. The specimens were rescored if the difference between the scores determined by the two pathologists was >3. The final score was stratified as follows: − (0, negative), + (1–3, weak), ++ (4–7, moderate), and +++ (8–12, strong). In the present study, − to+was considered low expression and ++ to +++ was considered high expression. Statistical analysis Computerized statistical analyses were performed using the Statistical Package for the Social Sciences (SPSS), version 18.0. The gene expression levels of HOTAIR in tumors were compared with adjacent normal tissues using the Wilcoxon test, whereas the associations between HOTAIR expression and clinical characteristics were evaluated using the chisquare test. Survival curves were estimated using the Kaplan–Meier method. The log-rank test was used to estimate the significant differences between the survival curves. A Cox proportional hazards analysis was performed to calculate the hazard ratio (HR) and the 95 % confidence interval (CI) to evaluate the association between HOTAIR expression and survival. Differences were considered significant if the P value from a two-tailed test was <0.05.

10252

Tumor Biol. (2014) 35:10249–10257

Results Clinical data and histopathology Median age at the time of diagnosis was 64 years (range 20– 87 years), and 27.3 % of the patients were female. Among the patients, 60 were in stage pTa, and 50 were in stage pT1. Grade was distributed as follows: G1, 58 and G2+G3, 52. Median follow-up was 39 months (range 4–60 months). Adjuvant therapy was administered to all patients with an 8-week course of intravesical mitomycin C (MMC) or pirarubicin (THP) instillation. The median follow-up duration in cases with recurrence was 36 months (range 7–60 months), and, in cases without recurrence, it was 28 months (range 7–60 months). Recurrence of the disease, which is defined as the reappearance of a lesion in the bladder more than 7 months after, intended curative treatment.

Correlations between HOTAIR expression and clinicopathological findings Upregulation of HOTAIR was frequently detected in Ta/ T1 BC tissues (Fig. 1a). Approximately 81.8 % (90/110) of the tumor tissues expression of HOTAIR was >1.5fold higher than the corresponding normal tissues. There was no significant association of the expression with gender, age, tumor size, and tumor stage as indicated in Table 1. The 110 patients were then divided into HOTAIR-high (n=90) and HOTAIR-low groups (n=20) or WIF-1-high (n=36) and WIF-1-low groups (n=74) according to the ROC curve method.

Table 1 Correlation between HOTAIR expression and clinicopathological characteristics in patients with Ta/T1 BC Parameters

Gender Fig. 1 HOTAIR is upregulated in Ta/T1 urothelial carcinoma of the bladder tissues (Ta/T1 BC). a The 110 total bladder cancer patients included in the study were divided into an elevated HOTAIR expression group (n=90) and a low HOTAIR expression group (n=20) according to the mean value of relative HOTAIR expression (2.65-fold, tumors/noncancerous). b Kaplan–Meier overall survival curves by HOTAIR level. Patients with elevated HOTAIR expression (n=90) showed reduced survival times compared with patients with low levels of HOTAIR expression (n=20; log-rank test; P<0.05). c Kaplan–Meier analysis showed that patients with elevated HOTAIR expression were correlated with higher recurrence rate; d Kaplan–Meier analysis showed that patients with higher WIF-1 expression were correlated with lower recurrence rate. *P<0.05

Age (years) Histological grade Tumor size Tumor stage n.s. not significant

Group

Male Female <59 ≥59 G1 G2, G3 <3.5 cm ≥3.5 cm Ta T1

Total

80 30 83 27 58 52 75 35 60 50

HOTAIR expression High

Low

63 27 68 22 31 59 62 28 46 44

17 3 15 5 2 18 13 7 14 6

P value

n.s. n.s. 0.031 n.s. n.s.

Tumor Biol. (2014) 35:10249–10257

10253

Table 2 Distribution of tumor recurrence rate in patients with Ta/T1 BC Parameters

Group

Recurrence

P value

Gender

Male Female <59 ≥59 G1 G2, G3 <3.5 cm ≥3.5 cm Ta T1 Low High Low High

24/80 7/30 22/83 9/27 8/58 23/52 25/75 6/35 20/60 11/50 25/74 6/36 3/20 28/90

n.s.

Age (years) Histological grade Tumor size Tumor stage WIF-1 expression HOTAIR expression

n.s. 0.008 n.s. n.s. 0.015

Correlations between tumor recurrence and HOTAIR expression There was no significant association between tumor recurrence and age, gender, tumor size, or stage. Histological grade was significantly correlated with tumor recurrence (Table 2). We next examined the relationship between tumor recurrence and HOTAIR and WIF-1 expression. There was a positive correlation between HOTAIR, WIF-1 expression, and disease recurrence (both P<0.05). In univariate and multivariate analysis, the relationship between the parameters studied and the recurrence-free survival rate was evaluated by univariate Cox regression analysis. No significant relation to the recurrence

Variable

Gender Male vs Female Age (years) ≥59 vs <59 Tumor size (cm) >3.5 vs <3.5 Tumor stage Ta vs T1 Histological grade G2, G3, vs G1 WIF-1 Low vs high HOTAIR High vs low

Altered migration and invasion of T24 cells by HOTAIR expression levels

0.000

n.s. not significant

Table 3 Prognostic factors in Cox proportional hazards model in Ta/T1 BC

rate was found for age, sex, stage, and tumor size. In contrast, histological grade (P<0.001) and the expression of HOTAIR (P=0.012) and WIF-1 (P<0.001) were found to be prognostic indicators of recurrence (Table 3; Fig. 1b, c). Subsequent multivariate Cox regression analysis showed that histological grade (hazard ratio 3.175; 95 % CI 2.411–6.279; P<0.001), WIF-1 (hazard ratio 3.972; 95 % CI 2.368–7.435; P=0.021), and HOTAIR (hazard ratio 4.712; 95 % CI 2.894–8.714; P<0.001) were independent predictors of recurrence in Ta/ T1 BC (Table 3).

HOTAIR expression in three BC cell lines was examined by qRT-PCR, revealing that the T24 cell line expressed the highest levels of HOTAIR (Fig. 2a). In addition, T24 cells were transfected with si-HOTAIR or si-NC using the Lipofectamine 2000. At 48 h after treatment, HOTAIR expression was effectively knocked down in T24 cells (Fig. 2b). The effects of HOTAIR on the migratory and invasive behavior of bladder cancer cell lines were assessed. Scratch wound assay showed that T24 cells infected with si-HOTAIR displayed significantly lower migration capacity compared with those infected with si-NC (Fig. 2c, d). Moreover, the invasion assay also indicated that suppression of HOTAIR in T24 cells with si-HOTAIR decreased invasion in the Matrigel substrate (Fig. 2e, f). These data indicated that HOTAIR is upregulation in BC cell lines and may be closely associated with migration and invasion capacity of bladder cancer cell lines.

Univariate analysis

Multivariate analysis

Risk ratio

95 % CI

P

Risk ratio

95 % CI

P

1.376

0.684–2.317

n.s.

1.618

0.794–2.582

n.s.

1.216

0.897–2.351

n.s.

2.864

2.117–4.673

n.s.

3.621

1.963–6.746

<0.001

3.175

2.411–6.279

<0.001

4.371

3.194–9.427

<0.001

3.972

2.368–7.436

0.021

6.371

3.149–12.316

0.012

4.712

2.894–8.714

<0.001

10254

Tumor Biol. (2014) 35:10249–10257

Fig. 2 In vitro assay results. a The relative expression levels of HOTAIR were confirmed via qRT-PCR in three bladder cancer cell lines. T24 cell lines expressed the highest levels of HOTAIR in the three bladder cancer cell lines. b The relative expression level of HOTAIR in T24 cells is significantly decreased by siHOTAIR compared with the siNC detected by qRT-PCR after transfection for 48 h. c, d Scratch wound assay results show inhibition of HOTAIR in T24 cells produced a lower migration capacity than observed in controls infected with si-NC. e, f T24 cells infected with si-HOTAIR displayed significantly lower invasion capacity compared with those infected with si-NC. Five areas were randomly selected in each chamber. The number of cells in these areas was counted, and results are expressed as means±SD for three replicate determination. All data analyzed using Student’s t test. *P<0.05

HOTAIR promoted H3K27 trimethylation in the WIF-1 promoter region and was inversely correlated with WIF-1 expression Consistent with the qRT-PCR results, the protein level of WIF-1 was greatly decreased after HOTAIR overexpression (Fig. 3a). Conversely, the knockdown of HOTAIR by siRNA restored the mRNA level of WIF-1; however, the protein level slightly changed (Fig. 3b). A dual luciferase reporter assay was performed to further demonstrate the inverse correlation between HOTAIR and WIF-1 expression. Compared to the T24-vector group, a significant decrease of luciferase fluorescence intensity was observed in the T24-HOTAIR group (Fig. 3c). Besides, it has been reported that EZH2 was the main component of PRC2, and HOTAIR exerting its function was PRC2 dependent. After

PRC2 depletion, there was a great increase of WIF-1 mRNA expression. Correspondingly, migration ability was greatly decreased (data not shown). After adding recombinant human WIF-1, it could significantly inhibit HOTAIR-induced migration and invasion capability (Fig. 3d). These results strongly indicated that HOTAIR-induced activity was WIF-1 dependent. The inverse correlation between HOTAIR and WIF-1 expression was further validated in 16 Ta/T1 BC clinical samples using qRT-PCR (Fig. 3e). Furthermore, immunohistochemistry analysis of WIF-1 expression in 110 BC tissues revealed that WIF-1 expression was significantly inversely correlated with HOTAIR expression (Fig. 3f, Table 4). Spearman correlation analysis indicated that there was a negative correlation between HOTAIR expression and WIF-1 mRNA levels (r=−0.417, P<0.05). Based on the regulatory mechanism in colorectal

Tumor Biol. (2014) 35:10249–10257

10255

Fig. 3 The mechanism of HOTAIR that promotes cell migration and invasion. a, b Analysis mRNA level of WIF-1 by qRT-PCR and protein level by Western blot in HOTAIR overexpression T24 cells (a) and HOTAIR RNAi T24 cells (b). c Analysis mRNA level of both WIF-1 and HOTAIR by qRT-PCR in 16 Ta/T1 BC. The relative mRNA level was normalized to the endogenous genes GAPDH. d Overexpression of HOTAIR inhibits WIF-1 promoter activity. e HOTAIR-induced invasion was inhibited by exogenous recombinant human WIF-1 (1 μg/ml, 48 h). e

WIF-1 expression by IHC. The images show four different tumor samples with different cytoplasmatic staining intensities against the WIF-1 protein. The IHC-score of 0, 1, 2, or 3 is shown at the lower right corner of each image. The examples are representative for the whole set of samples. g CHIP assay in T24-Vector or HOTAIR cells. Primer locations are indicated in the WIF-1 schematic. The PCR products were quantitated by Gel Analyzer (error bars=SD, n=3). *P<0.05

cancer, the levels of histone H3K27 trimethylation in T24Vector and T24-HOTAIR cells were measured. CHIP clearly demonstrated that there was a significant increase in H3K27 trimethylation in the WIF-1 promoter (Fig. 3g).

indicator of Ta/T1 BC. In fact, HOTAIR overexpression was also discovered to be associated with poor prognosis in other cancers [18, 19]. It was believed that this tendency would be demonstrated in more cancers. Furthermore, the expression of HOTAIR appears to be positively correlated with the severity of the cancer [20]. Our findings strengthened the clinical value of HOTAIR. It was reported that HOTAIR, in collaboration with PRC2, reprogrammed the chromatin state and regulated the expression of hundreds of genes by epigenetic regulation to promote

Discussion In our present study consisting of 110 bladder cancer patients, HOTAIR was demonstrated as an independent prognostic

10256

Tumor Biol. (2014) 35:10249–10257 Table 4 The relationship between WIF-1 and HOTAIR expression HOTAIR expression

WIF-1 expression

High Low

Total Percentage (H/T)

High

Low

21 69 90 23.3 %

15 5 20 75 %

P value

0.000

Spearman’s correlation=−0.417 P<0.05

Fig. 3 continued.

cancer metastasis [21]. Considering the regulatory complexity and diversity in different types of tumors, it was necessary to conduct a systematic study in BC. As we reported, HOTAIR downregulation inhibits migration and invasion in BC T24 cell lines (Fig. 2c–f). As previous observations indicated that cancer cells in the digestive organs and breast organs tend to express HOTAIR, however, its expression status and clinico-pathologic significance in bladder cancer remain largely unknown. In the present study, we found that high-HOTAIR cases were detected in 81.8 % of patients with Ta/T1 BC, and HOTAIR was positively correlated with the recurrence rate of Ta/T1 BC.

Epigenetic disruptions, including promoter CpG island methylation and histone modification of tumor-related genes, have been identified as key events in cancer development. As literature reported, the expression of Wnt signaling-related genes such as APC, SFRP1⁄2, Wnt5A, and WIF-1 was all changed after promoter region methylation (Table 5). The inverse correlation between HOTAIR overexpression and decreased WIF-1 expression was validated in both BC cells and tissues (Fig. 3a–g). From our study, we found that a high level of HOTAIR was associated with unfavorable prognosis. Moreover, patients with high-HOTAIR expression were more likely to develop recurrence compared with those low-HOTAIR patients (hazard ratio 4.712; 95 % CI 2.894–8.714; P<0.001). Although a direct interaction between HOTAIR and PRC2 in BC cells is not yet reported, the abnormal PRC2 expression has been associated with various cancers, and HOTAIR was proved to directly interact with PRC2 in types of tumors [22]. The HOTAIR/WIF-1 regulatory model identified in this study provides a novel view on WIF-1 regulation. In fact, WIF-1 downregulation has been reported to be involved in progression in types of tumors including BC. Rubin et al. have reported that inhibition of WIF-1 could trigger Wnt/β-catenin signaling and thereby promotes tumor invasion and migration [23], as we found the correlation between WIF-1 protein level and prognosis of patients with Ta/T1 BC. Further supporting the aforementioned associations with the pathological parameters, HOTAIR was also associated with an unfavorable impact on the patients’ prognoses. Univariate Cox Table 5 Primers in WIF-1 promoter region Name

Primers

WIF-1 P1-F WIF-1 P1-R WIF-1 P2-F WIF-1 P2-R WIF-1 P3-F WIF-1 P3-R

AACCCTTTTGCTTCCGTTTT AAAGTTGCCGAATTCACAGG GGCAATTTGCGCCTTCAG CTTCGGGGGAGGGAAATG ATGTCCCAGGGGTCTCTGA GAGAACAGAAGAGCGGGAAG

Tumor Biol. (2014) 35:10249–10257

regression analysis showed tumor grade, WIF-1 expression, and HOTAIR expression to be significantly correlated with the recurrence rate. In a multivariate Cox regression model, HOTAIR was an independent prognostic factor. Therefore, our study indicated that high-level expressions of HOTAIR predicted disease recurrence in patients with Ta/T1 BC. Accordingly, patients with G2 and G3, WIF-1-negative, as well as HOTAIR-positive tumors have a high risk to develop recurrence. And, adjuvant or more aggressive treatment should be administered in this group of patients.

Conclusion Our results suggested an association between HOTAIR expression and increased risk of recurrence in Ta/T1 BC. HOTAIR may serve as a useful marker for predicting recurrence in patients with Ta/T1 BC. Acknowledgments This work was supported by grants from the Foundation of Longyan Medical Science and Technique Key Program (No. 2013LY57). Conflicts of interest None

References 1. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin. 2013;63:11–30. 2. Heney NM, Ahmed S, Flanagan MJ, et al. Superficial bladder cancer: progression and recurrence. J Urol. 1983;130:1083–6. 3. Stein JP, Lieskovsky G, Cote R, Groshen S, Feng AC, Boyd S, et al. Radical cystectomy in the treatment of invasive bladder cancer: longterm results in 1,054 patients. J Clin Oncol. 2001;19:666–75. 4. Stenzl A, Cowan NC, De Santis M, et al. Treatment of muscleinvasive and metastatic bladder cancer: update of the EAU guidelines[J]. Eur Urol. 2011;59(6):1009–18. 5. Lee JT. Lessons from X-chromosome inactivation: long ncRNA as guides and tethers to the epigenome. Genes Dev. 2009;23:1831–42. 6. Hung T, Chang HY. Long noncoding RNA in genome regulation: prospects and mechanisms. RNA Biol. 2010;7:582–5.

10257 7. Cheetham SW, Gruhl F, Mattick JS, Dinger ME. Long noncoding RNAs and the genetics of cancer. Br J Cancer. 2013;108:2419–25. 8. Li CH, Chen Y. Targeting long non-coding RNAs in cancers: progress and prospects. Int J Biochem Cell Biol. 2013;45:1895–910. 9. Kogo R, Shimamura T, Mimori K, et al. Long noncoding RNA HOTAIR regulates polycomb-dependent chromatin modification and is associated with poor prognosis in colorectal cancers[J]. Cancer Res. 2011;71(20):6320–6. 10. Gupta RA, Shah N, Wang KC, et al. Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis[J]. Nature. 2010;464(7291):1071–6. 11. Yang Z, Zhou L, Wu LM, et al. Overexpression of long non-coding RNA HOTAIR predicts tumor recurrence in hepatocellular carcinoma patients following liver transplantation[J]. Ann Surg Oncol. 2011;18(5):1243–50. 12. Niinuma T, Suzuki H, Nojima M, et al. Upregulation of miR-196a and HOTAIR drive malignant character in gastrointestinal stromal tumors. Cancer Res. 2012;72:1126–36. 13. Wang J, Sinha T, Wynshaw-Boris A. Wnt signaling in mammalian development: lessons from mouse genetics. Cold Spring Harb Perspect Biol. 2012;4. 14. Yang SH, Li SL, Dong ZM, Kan QC. Epigenetic inactivation of Wnt inhibitory factor-1 in human esophageal squamous cell carcinoma. Oncol Res. 2012;20:123–30. 15. Pez F, Lopez A, Kim M, Wands JR, Caron de Fromentel C, Merle P. Wnt signaling and hepatocarcinogenesis: molecular targets for the development of innovative anticancer drugs. J Hepatol. 2013;59: 1107–17. 16. Sobin LH, Fleming ID. TNM classification of malignant tumors. Cancer. 1997;80:1803–4. 17. Mostofi FK, Davis CJ, Sesterhenn IA, Sobin LH. Histological typing of urinary bladder tumours. Berlin: Springer; 1999. 18. Ge XS, Ma HJ, Zheng XH, et al. HOTAIR, a prognostic factor in esophageal squamous cell carcinoma, inhibits WIF-1 expression and activates Wnt pathway. Cancer Sci. 2013;104:1675–82. 19. Liu XH, Liu ZL, Sun M, Liu J, Wang ZX, De W. The long noncoding RNA HOTAIR indicates a poor prognosis and promotes metastasis in non-small cell lung cancer. BMC Cancer. 2013;13:464. 20. Endo H, Shiroki T, Nakagawa T, et al. Enhanced expression of long non-coding RNA HOTAIR is associated with the development of gastric cancer. PLoS One. 2013;8:e77070. 21. Kaneko S, Li G, Son J, et al. Phosphorylation of the PRC2 component Ezh2 is cell cycle-regulated and up-regulates its binding to ncRNA. Genes Dev. 2010;24:2615–20. 22. Wang L, Zeng X, Chen S, et al. BRCA1 is a negative modulator of the PRC2 complex. EMBO J. 2013;32:1584–97. 23. Rubin EM, Guo Y, Tu K, Xie J, Zi X, Hoang BH. Wnt inhibitory factor 1 decreases tumorigenesis and metastasis in osteosarcoma. Mol Cancer Ther. 2010;9:731–41.