J Plant Res (2012) 125:579–586 DOI 10.1007/s10265-011-0469-z
REGULAR PAPER
Visualization of microbodies in Chlamydomonas reinhardtii Yasuko Hayashi • Akiko Shinozaki
Received: 24 July 2011 / Accepted: 12 December 2011 / Published online: 29 December 2011 Ó The Botanical Society of Japan and Springer 2011
Abstract In Chlorophycean algal cells, these organelles are generally called microbodies because they lack the enzymes found in the peroxisomes of higher plants. Microbodies in some algae contain fewer enzymes than the peroxisomes of higher plants, and some unicellular green algae in Chlorophyceae such as Chlamydomonas reinhardtii do not possess catalase, an enzyme commonly found in peroxisomes. Thus, whether microbodies in Chlorophycean algae are similar to the peroxisomes of higher plants, and whether they use a similar transport mechanism for the peroxisomal targeting signal (PTS), remain unclear. To determine whether the PTS is present in the microbodies of Chlorophycean algae, and to visualize the microbodies in Chlamydomonas cells, we examined the sub-cellular localization of green fluorescent proteins (GFP) fused to several PTS-like sequences. We detected GFP compartments that were spherical with a diameter of 0.3–1.0 lm in transgenic Chlamydomonas. Comparative analysis of the character of GFP-compartments observed by fluorescence microscopy and that of microbodies by electron microscopy indicated that the compartments were one and the same. The result also showed that the microbodies in Chlorophycean cells have a similar transport mechanism to that of peroxisomes of higher plants.
Y. Hayashi A. Shinozaki Graduate School of Science and Technology, Niigata University, 8050 Ikarashi, Ninotyou, Niigata, Niigata 950-2181, Japan Y. Hayashi (&) Department of Environmental Science, Faculty of Science, Niigata University, 8050 Ikarashi, Ninotyou, Niigata, Niigata 950-2181, Japan e-mail:
[email protected]
Keywords Chlamydomonas GFP Microbody Peroxisome Peroxisomal targeting signal (PTS)
Introduction Microbodies were first described by Rhodin (1954) according to their distinctive morphological features on electron micrographs. Microbodies can be identified by their single membrane and roughly spherical shape with a diameter of 0.2–1.5 lm (Beevers 1979). On the other hand, peroxisomes are generally defined as organelles containing at least one H2O2-producing oxidase in addition to catalase, an enzyme that reduces H2O2 to water (De Duve and Baudhuin 1966). This difference in definition raises the possibility that organelles identified as microbodies may include peroxisomes as well as other organelles. In higher plants, peroxisomes are classified into three groups, namely, glyoxysomes, leaf peroxisomes and unspecialized peroxisomes, distinguishable by their enzyme complements (Beevers 1982; Huang et al. 1983). As each group of peroxisomes has an enzyme that reduces H2O2 to water as well as other general peroxisomal enzymes (e.g., catalase), and as each group uses the same transport system, the organelles can be considered identical (Hayashi et al. 2000; Mano et al. 2002). Microbodies have been isolated from various algal species, and previous studies have found that microbodies in Mougeotia and Spirogyra (both of Charophyceae) are similar to the peroxisomes in the leaf of higher plants (Stabenau and Sa¨ftel 1981; Stabenau 1984). On the other hand, microbodies in some green algae (e.g., Dunaliella and Etemosphaera: both of Chlorophyceae) contain fewer enzymes than the peroxisomes of higher plants (Stabenau 1974a, b, 1984; Stabenau et al. 1993). Nowadays, it is
123
580
common knowledge that microbodies in Chlorophyceae are similar to unspecialized peroxisomes of higher plants. In Chlamydomonas, catalase activity is located in the mitochondrial fraction (Kato et al. 1997). In other studies, 3, 30 -diamino-benzidine (DAB) staining has been used to determine whether algal organelles contain several H2O2producing oxidases and H2O2-degrading enzymes, such as catalase. However, the microbodies in some algae (e.g., Chlorogonium elongatum and Chlamydomonas spp.) do not respond to DAB staining (Silverberg and Sawa 1974; Silverberg 1975a, b). This led us to speculate that microbodies in Chlorophycean algal cells may not be the same organelles as the peroxisomes of higher plants. Most peroxisomal enzymes are synthesized on free polysomes in the cytosol and then imported into peroxisomes (Baker 1996; Olsen and Harada 1995; Subramani 1993). In plants, yeasts and animals, peroxisomal enzymes have a peroxisomal targeting signal at the C-terminus (PTS1) or N-terminus (PTS2). PTS1 consists of a unique tripeptide sequence, Ser-Lys-Leu, or derivations of this sequence at the C-terminus. The PTS1 sequences are involved in the transport of peroxisomal enzymes in insects, higher plants and yeasts (Gould et al. 1990; Blattner et al. 1992). PTS2 consists of a consensus presequence, Arg-Leu/Gln/Ile-X5-His-Leu, located at the N-terminus (Gietl 1996; De Hoop and Ab 1992; Subramani 1993). In our previous paper, we examined the sub-cellular localization of green fluorescent proteins (GFP) proteins fused with PTS sequences in Closterium ehrenbergii (Shinozaki et al. 2009). Our findings revealed that the PTS is active in the microbodies of Charophycean green algae. To determine whether the PTS exists in the microbodies of Chlorophycean green algae, and to visualize the microbodies in Chlamydomonas cells, we examined the sub-cellular localization of GFP proteins fused with the PTS sequences in Chlamydomonas cells. If the peroxisome transport system of higher plants is present and functioning in microbodies in Chlorophycean green algae, these microbodies can possibly be called as peroxisomes, despite lacking the general enzymes present in peroxisomes.
Materials and methods Strains and culture conditions Chlamydomonas reinhardtii P.A. Dangeard strains CC125 (wild-type, mt?) and CW15 (cell wall-less mutant, mt?) were obtained from Dr. Ohama (Kochi University of Technology, Kochi, Japan). Cells were grown in minimum medium at 22°C with a photocycle of 14:10 (light:dark). Illumination was continuous at 8 lmol m-2 s-1.
123
J Plant Res (2012) 125:579–586
Plasmid construction We constructed plasmids for expression of GFP tagged with various PTSs using pCrGFP (Entelechon, Regensburg, Germany) and pSP103 (Sizova et al. 2001). The plasmid pSP103 contains an engineered promoter consisting of both the hsp70A promoter and the rbcS2 promoter from C. reinhardtii plus enhancer sequences, as well as the aphVIII gene for paromomycin resistance. For the GFP control construct, CrGFP instead of aphVIII was inserted downstream of this promoter into pSP103. For the GFP ? PTS1 and GFP ? PTS1-like constructs, first GFP ? PTS1 and GFP ? PTS1-like were constructed by adding a 33-bp fragment from the C-terminal region of pumpkin malate synthase (P-MS) or Chlamydomonas malate synthase (C-MS) to the 30 end of CrGFP using a three-step PCR method. The first PCR step used the CrGFP gene as the template to add a 12-bp fragment from the C-terminal region of P-MS or C-MS to the 30 end of CrGFP. For the first PCR, we used the following primer sets (defined below): GFP ? PTS1F and GFP ? PTS1R1 for GFP ? PTS1, and GFP ? PTS1-likeF and GFP ? PTS1-likeR1 for GFP ? PTS1-like. The first PCR products were then used as the templates in the second PCR. A 24-bp fragment from the C-terminal region of P-MS or C-MS was added to the 30 end of CrGFP. The primer set of GFP ? PTS1F and GFP ? PTS1R2 was used for the second PCR to create GFP ? PTS1, and the primer set GFP ? PTS1-likeF and GFP ? PTS1-likeR2 was used to create GFP ? PTS1-like. In the third PCR, we used the second PCR products as the templates. To create GFP ? PTS1 and GFP ? PTS1-like, an additional 33-bp fragment from the C-terminal region of P-MS or C-MS was fused to the 30 end of CrGFP. In the third PCR, the primer set of GFP ? PTS1F and GFP ? PTS1R3 was used to make GFP ? PTS1 and the primer set GFP ? PTS1-likeF and GFP ? PTS1-likeR3 was used to make GFP ? PTS1like. The resulting DNA fragments were inserted into pSP103 as EcoRI-BamHI fragments. To produce a pPTS2 ? GFP construct, pPTS2 was amplified by PCR using ptCSC5 (Kato et al. 1995) as the template and pPTS2F and pPTS2R as primers. The fragments were inserted into GFP control constructs as EcoRI–EcoRI fragments. In the case of the cPTS2 ? GFP construct, cPTS2 was amplified by RT-PCR using Chlamydomonas total RNA as the template, and cPTS2F and cPTS2R as primers. The fragments were then inserted into GFP control constructs as EcoRI–EcoRI fragments. The primer sequences for PCR were as follows: GFP ? PTS1F (sense) 50 -GGGGGGAATTCATGGCCAAGGGCGAGGAG-3 0 ; GFP ? PTS1R1 (antisense) 50 -GGGATGATGTATCTTG TACAGCTCGTCCATGC-30 ; GFP ? PTS1R2 (antisense) 50 -GGACAGCTCCCTGGGATGATGTATCTTGTACA-30 ;
J Plant Res (2012) 125:579–586
GFP ? PTS1R3 (antisense) 50 -AAAGGATCCTCAGAGC CTGGACAGCTCCCTGGGATGAT-30 ; GFP ? PTS1-likeF (sense) 50 -GGGGGGAATTCATGGCCAAGGGCGAGGA G-30 ; GFP ? PTS1-likeR1 (antisense) 50 -CGATGTGGA GATCCTTGTACAGCTCGTC-30 ; GFP ?PTS1-likeR2 (antisense) 50 -GGGTCTTTGGTGACGA TGTGGAGATC CTTGTACAG-30 ; GFP ? PTS1-likeR3 (antisense) 50 -AA AGGATCCTCACATGCGGCTGGGG GTCTTGGTG-30 ; PTS2F (sense) 50 -GGGGAATCC ATGCCCACCGACAT G-30 ; PTS2R (antisense) 50 -AA AGAATTCCATGGTCTG AGCTGA-30 ; PTS2-likeF (sense) 50 -GGGGAATCCATGG CTGACCCACTGAA CC-30 and PTS2-likeR (antisense) 50 -AAAGAATTCGC GCCAGGTCTGACACGTA-30 . Transformation of Chlamydomonas by electroporation The CW15 cell cultures were chilled on ice prior to the addition of a 10% Tween-20 solution at 1/2000 (v/v) to facilitate pelleting of the C. reinhardtii cells. The cells were collected by centrifugation at 1,5009g for 5 min at 4°C and resuspended in Tris–acetate phosphate (TAP) medium containing indicated concentrations (typically 40 mM) of sucrose to a final density of from 1 9 108 to 4 9 108 cells per ml. Under standard conditions, 10 mg/ml of plasmid DNA and 200 mg/ml of carrier DNA were then added. At this time, plasmid DNA was mixed with our construct and pSP103 (original construct for paromomycin resistance). A cell suspension of 250 ll was placed into a disposable electroporation cuvette with a 4-mm gap (BioRad Labs., Hercules, CA, USA), which was then immersed in a water bath to maintain specified temperatures. An exponential electric pulse (typically from 1,900 to 2,400 V/cm) was applied to the sample using the Gene Pulser Xcell electroporation apparatus (Bio-Rad). Unless otherwise noted, the capacitance was set at 10 mF and no shunt resistor was used. Following electroporation, the cuvette was removed from the electroporation apparatus and incubated in a 25°C water bath for at least 5 min, after which an aliquot of the cell suspension was plated onto solid medium containing 10 mg/l of paromomycin (Invitrogen, San Diego, CA, USA) by the starch embedding method (Shimogawara et al. 1998). The plates were cultured at 8 lmol m-2 s-1 at 22°C. We selected the positive strains that contained both the construct for the expression of GFP tagged with various PTSs and the construct for paromomycin resistance. Fluorescence microscopy GFP fluorescence was visualized using a BX-FLA fluorescence microscope (OLYMPUS, Japan) with a 480-nm excitation filter and 515-nm barrier filter. Chloroplastic autofluorescence was visualized using a 550-nm excitation
581
filter and 590-nm barrier filter. To detect the shape of mitochondria, cells were treated with 0.5 lM MitoTrackerÒ Green FM solution (Invitrogen, San Diego, CA, USA) and washed twice with the culture medium before observation. Electron microscopy For electron microscopy, wild-type or transgenic C. reinhardtii cells were fixed with 2% (v/v) glutaraldehyde, postfixed with 2% (w/v) KMnO4 (in pH.7 phosphate buffer at 4°C) and then block stained with 1% (w/v) uranyl acetate. After six rinses in water, the fixed cells were dehydrated in an ethanol series, exchanged with propylene oxide, and finally embedded in a low-viscosity epoxy resin. Thin sections cut with a diamond knife were stained with lead citrate and examined using an electron microscope (H-700, HITACHI, Tokyo, Japan).
Results We searched the database of the Chlamydomonas genome (JGI; Joint Genome Institute Chlamydomonas reinhardtii v3.0) for protein coding sequences with PTS1- or PTS2like peptides. We found that malate synthetase (MS: XP_001695632) has a PTS1-like motif (SRM) at the C-terminus and that malate dehydrogenase (MDH: XP_001702586) has a PTS2-like motif (RI-X5-HL) in the N-terminal domain. MS and MDH are involved in glyoxylate metabolism and are located in the peroxisomes in higher plants. To determine whether the PTS-like sequences of MS and MDH proteins in Chlamydomonas have a function to deliver the proteins to microbodies, we analyzed the subcellular localization of GFP fused with pumpkin PTS (pPTS) and Chlamydomonas PTS (cPTS) sequences in transgenic Chlamydomonas. We constructed chimeric genes by fusing a modified GFP for C. reinhardtii (Chiu et al. 1996; Niwa et al. 1999) and amino acid sequences of PTS1 or PTS2 as shown in Fig. 1. pPTS1 and pPTS2 have been previously identified as peroxisomal targeting signals in pumpkin (Hayashi et al. 1996; Kato et al. 1995). pPTS1 and cPTS1, which consist of the nucleotide sequences encoding the 10 amino acids derived from the C-terminus of pumpkin MS (IHHPRELSRL) and Chlamydomonas MS (HIVTKTPSRM), respectively, were fused to the 30 end of the GFP coding sequence. pPTS2 (RL-X5-HL) and cPTS2 (RI-X5-HL), which made up the pre-sequence at N-terminus of pumpkin citrate synthase and Chlamydomonas MDH, respectively, were fused to the 50 end of the GFPcoding sequence. The chimeric fusion genes were inserted downstream of an engineered promoter consisting of the
123
582
J Plant Res (2012) 125:579–586
C. reinhardtii hsp70A promoter and the C. reinhardtii rbcS2 promoter in addition to the enhancer sequence. These constructs and a construct for resistance against paromomycin were introduced into C. reinhardtii cells by electroporation. The cells were selected on TAP agar plates
Fig. 1 Constructs of the modified GFPs expressed in Chlamydomonas cells. Five modified GFPs are schematically represented. GFP: CrGFP only without the signal peptide sequence; GFP ? pPTS1: CrGFP followed by a 10-amino-acid sequence derived from pumpkin malate synthase; pPTS2 ? GFP: the N-terminal pre-sequence from pumpkin citrate synthase was inserted into the N-terminus of CrGFP; GFP ? cPTS1: 10 amino acids from Chlamydomonas malate synthase were inserted into the C-terminus of CrGFP; and cPTS2 ? GFP: the N-terminal pre-sequence from Chlamydomonas malate dehydrogenase was inserted into the N-terminus of CrGFP. Underlined sequences represent important regions for the PTS1 import system. Boxes show the consensus sequence of PTS2. hsp70Ap: hsp70A promoter; rbcS2p: rbcS2 promoter; rbcS2t: 30 signal of rbcS2
a
b
c
d
e
f
g
h
i
j
Fig. 2 Subcellular localization of GFP–PTS fusion proteins in transgenic Chlamydomonas reinhardtii cells. The upper row of panels shows the GFP fluorescence (a–e) and the lower row shows GFP fluorescence images overlaid with intrinsic fluorescence of chloroplasts (f–j). The cells expressing the untagged GFP protein
123
containing paromomycin and screened for GFP expression by fluorescence microscopy. When GFP lacking the peroxisomal targeting sequence was expressed, green fluorescence was observed in the cytosol (Fig. 2a), indicating that the promoter was functional in Chlamydomonas cells. In contrast, when the GFP ? pPTS1 and GFP ? pPTS2 fusion proteins were expressed in Chlamydomonas cells, fluorescence was detected in small, spherical, intracellular compartments with a diameter of 0.3–1.0 lm (Fig. 2b, c). Based on our observations, the number of fluorescent structures in one cell was from one to three. As for the GFP ? cPTS1 and GFP ? cPTS2 fusion proteins, fluorescence was also detected in small, intracellular compartments similar to those described for GFP ? pPTS1 and GFP ? pPTS2 (Fig. 2d, e). Panels f–j in Fig. 2 show GFP fluorescence images overlaid with autofluorescence images of chloroplasts. These results clearly demonstrate that the pPTS and cPTS amino acid sequences could act as targeting signals for one or more specific organelles in C. reinhardtii cells. In order to confirm that these GFP-accumulating compartments were microbodies, we further observed cells expressing GFP ? cPTS1 fusion proteins by electron microscopy (Fig. 3). Electron micrographs revealed that the microbodies had a distinctive uni-membrane structure. The number of microbodies in cross-sections was from zero to three, and the microbodies observed by electron microscopy appeared to have the same shape, size and distribution to the GFP compartments observed by fluorescence microscopy. The absence of any abnormal aggregates of proteins in the cytosol of cells expressing GFP ? pPTS or GFP ? cPTS fusion proteins indicated that the GFP fluorescent compartments in these cells were in fact organelles. Vesicles and vacuoles have various sizes and exist in cells in high numbers. Therefore, it is not
show fluorescence around the nucleus and cytoplasm, as the control (a, f). GFP ? PTS fusion proteins were located in small intracellular compartments, b, g GFP ? pPTS1; c, h pPTS2 ? GFP; d, i GFP ? cPTS1; e, j cPTS2 ? GFP. Bar indicates 1 lm and refers to all samples
J Plant Res (2012) 125:579–586
possible that only a single vesicle or vacuole will accumulate GFP proteins. Morphological data obtained from thin sections of C. reinhardtii cells indicated that the GFP fluorescent compartments were microbodies or mitochondria. However, previous studies have reported that mitochondria in C. reinhardtii exhibit the following five variations in shape during the cell cycle: giant global mitochondria, mitochondria composed of thick-corded
583
bodies connected to each other, thin-corded forms with only a few branches, small lump forms scattered in the cytoplasm and stringy forms with intricate branching (Ehara et al. 1995; Aoyama et al. 2006). Next, we also tried to stain mitochondria in C. reinhardtii cells with Mito Tracker solution (Fig. 4) and subsequently detected various shapes of mitochondria by fluorescence microscopy. In the present study, the GFP fluorescent structures did not change their shape during the cell cycle and their shape always remained spherical, indicating that the GFP fluorescent compartments were not mitochondria. We also carefully observed the inner structures of C. reinhardtii cells by electron microscopy. Comparative analysis of the character of GFP-compartments observed by fluorescence microscopy and that of microbodies by electron microscopy indicated that the fluorescent structures and microbodies were the same.
Discussion
Fig. 3 Electron micrograph of a GFP ? cPTS1 transgenic cell. A peroxisome-like structure with a spherical shape and limited by a single membrane can be observed in the cell (asterisk). The number of structures with these characteristics was from zero to three in each section. The size of this structure was comparable to the fluorescence structure observed in the transgenic cells. There were no protein aggregates in the cytosol. b is a high magnification figure of the white square area in a. Ch chloroplast, N nucleus, Mt mitochondria, V vacuole. Bar indicates 1 lm
Fig. 4 Shape of mitochondria in Chlamydomonas cells. Cells were treated with Mito Tracker. We detected various shape of mitochondria during the cell cycle; giant global mitochondria (a), mitochondria
In Prasinophyceae, microbodies are not involved in glycolate metabolism and contain enzymes of b-oxidation; the glycolate pathway is exclusively mitochondrial. In Chlorophyceae and Ulvophyceae, except Charophyceae, mitochondria have enzymes of glycolate metabolism (Frederick et al. 1973), and glycolate is metabolized by mitochondrial glycolate dehydrogenase. In both Dunaliella and Eremosphaera (Chlorophyceae), microbodies contain catalase, uricase (Stabenau 1984) and hydroxyacyl-CoA dehydrogenase, while glycolate dehydrogenase and hydroxypyruvate reductase are located in mitochondria (Stabenau et al. 1993). In C. reinhardtii, catalase is found in the mitochondria (Kato et al. 1997). On the other hand, in the multicellular green algae Mougeotia, Chara and Nitella
composed of thick-corded interconnected bodies (b, c) and stringy forms with intricate branching (d). Bar indicates 1 lm
123
584
(Charophyceae), which are found along the evolutionary line of higher plants, the microbodies contain enzymes attributed to the leaf peroxisomes of higher plants (Kehlenbeck et al. 1995). In our previous paper, we reported that GFP proteins fused with the PTS sequences transported into the microbodies of C. ehrenbergii of Charophyceae (Shinozaki et al. 2009). The next question is whether microbodies of Chlorophycean green algae, in which some of the enzymes of these metabolic pathways found in higher plant peroxisomes are absent, have the same transport system as the peroxisomes of higher plants. Our data shows that when fused to GFP, the peptide known as PTS in higher plants and yeasts is capable of transferring the fusion proteins into the microbodies of Chlamydomonas cells. Furthermore, additional amino acid sequences that were identified from the database of the Chlamydomonas genome as PTS-like sequences can act as targeting signals of microbodies. This suggests that microbodies in Chlamydomonas cells have a PTS transport mechanism similar to that of higher plants, and that Chlamydomonas MS and Chlamydomonas MDH, which contain these PTS-like sequences, would be localized to the microbodies. MS and MDH are glyoxysomal enzymes involved in the glyoxylate cycle in higher plants. It may also be assumed that some enzymes of the glyoxylate cycle are located in the peroxisomes of Chlamydomonas, despite the fact that isocitrate lyase and other specific enzymes of the glyoxylate cycle, such as ICL, lack any known targeting sequence for peroxisomal transport. The targeting signal transport systems of PTS1 and PTS2 need cytosolic receptors that recognize the PTS signal peptides. Enzymes that contain PTS1 are synthesized in a form similar in size to the mature protein and imported into peroxisomes via recognition by the PTS1 receptor Pex5p (Jardim et al. 2000; Szilard et al. 1995; Terlecky et al. 1995; Van der Leij et al.1993). Peroxisomal proteins with PTS2 sequences are synthesized in the cytosol as precursor proteins with masses greater than those of the mature proteins and are recognized by the PTS2 receptor Pex7p (Marzioch et al. 1994). From the database of the Chlamydomonas genome, we also identified homologues of the PTS receptor genes, PEX5 (XP_001690276) and PEX7 (XP_001701515). PEX5 encodes the PTS1 receptor (Wimmer et al. 1998) and PEX7 the PTS2 receptor (Marzioch et al. 1994). However, the molecules involved in the signal transport system differ depending on the species (McNew and Goodman 1996; Erdmann and Blobel 1996; Albertini et al. 1997; Komori et al. 1997). It has been suggested that PTS1 targeting may have been conserved throughout the evolution of eukaryotes (Gould et al. 1990); however, there are some organisms that lack the PTS2 protein machinery (Motley et al. 2000). On the
123
J Plant Res (2012) 125:579–586
other hand, enzymes with PTS1 sequences, but not PTS2 sequences, have been identified from the Cyanidioschyzon merolae (Bangiophyceae: red algae) genome database (Matsuzaki et al. 2004). In animals, it has been hypothesized that the PTS2 import machinery was lost during evolution (Gould et al. 1990; Motley et al. 2000). The findings of our previous paper and the present results indicate that PTS1 and PTS2 can act as a PTS in Charophycean and Chlorophycean algal cells. With regard to the transport of peroxisomal proteins, our results suggest that the transport mechanism of not only PTS1 but also PTS2 might have been conserved throughout the evolution of the Chlorophyta lineage. In the present study, our morphological data correctly indicated that GFP fluorescent structures are microbodies, and we successfully visualized microbodies in chlamydomonas and developed a valuable tool to research microbody behavior. In fact, we deliberated on how to detect the distribution of GFP in cells expressing GFP ? cPTS1 fusion proteins by immunoelectron microscopic analysis, as the expressed protein of crGFP did not react with any kind of anti-GFP antibodies used in plants and animals. The fact that crGFP is a modified gene for the high GC-content of C. reinhardtii might the reason. We also considered another way to detect microbodies using immunoelectron microscopy or immunofluorescent microscopy analysis, but no antibody that specifically reacts with microbodies or specific molecular probes for microbodies of Chlamydomonas reinhardtii are currently available. Even catalase, which is a normal marker of peroxisomes, is not found in the peroxisomes of Chlamydomonas reinhardtii cells (Kato et al. 1997), and existing emzymes in the peroxisomes of Chlamydomonas cells cannot be revealed because we do not know the role of peroxisomes in Chlamydomonas (Stabenau et al. 1993). Since many unresolved issues persist for study of peroxisomes in Chlamydomonas, we believe that visualization of microbodies in Chlamydomonas cells might be a good way to initiate future study on peroxisomes in Chlamydomonas. In future studies, therefore, we intend to focus on further elucidation of the role of microbodies in Chlamydomonas cells and the evolution and diversity of organelles that have been named microbodies. Acknowledgments We thank Dr. Takeshi Ohama of Kochi University of Technology for providing the plasmid pSP103 and Dr Akira Kato of Niigata University for providing cDNA of pumpkin citrate synthase. This work was supported by a Grant for Promotion of Niigata University Research Projects.
References Albertini M, Rehling P, Erdmann R, Girzalsky W, Kiel JA, Veenhuis M, Kunau WH (1997) Pex14p, a peroxisomal membrane protein
J Plant Res (2012) 125:579–586 binding both receptors of the two PTS-dependent import pathways. Cell 89:83–92 Aoyama H, Hagiwara O, Misumi O, Kuroiwa T, Nakamura S (2006) Complete elimination of maternal mitochondrial DNA during meiosis resulting in the paternal inheritance of the mitochondrial genome in Chlamydomonas species. Protoplasma 228:231–242 Baker A (1996) In vitro systems in the study of peroxisomal protein import. Experienti 52:1055–1062 Beevers H (1979) Microbodies in higher plants. Annu Rev Plant Physiol 30:159–197 Beevers H (1982) Glyoxysomes in higher plants. Ann NY Acad Sci 386:243–253 Blattner J, Swinkels B, Dorsam H, Prospero T, Subramani S, Clayton C (1992) Glycosome assembly in trypanosomes:variation in the acceptable degeneracy of a COOH-terminal microbody targeting signal. J Cell Biol 119:1129–1136 De Duve C, Baudhuin P (1966) Peroxisomes (microbodies and related particles). Physiol Rev 46:323–357 Chiu WI, Niwa Y, Zeng W, Hirano T, Kobayashi H, Sheen J (1996) Engineered GFP as a vital reporter in plants. Curr Biol 6:325–330 De Hoop MJ, Ab G (1992) Import of proteins into peroxisomes and other microbodies. Biochem J 286:657–669 Ehara T, Osafune T, Hase E (1995) Behavior of mitochondria in synchronized cells of Chlamydomonas reinhardtii (Chlorophyta). J Cell Sci 108:499–507 Erdmann R, Blobel G (1996) Identification of Pex13p a peroxisomal membrane receptor for the PTS1 recognition factor. J Cell Biol 135:111–121 Frederick SE, Gruber PJ, Tolbert NE (1973) The occurrence of glycolate dehydrogenase and glycolate oxidase in green plants. An evolutionary survey. Plant Physiol 52:318–323 Gietl C (1996) Protein targeting and import into plant peroxisomes. Physiol Plant 97:599–608 Gould SJ, Keller GA, Schneider M, Howell SH, Garrard LJ, Goodman JM, Distel B, Tabak H, Subramani S (1990) Peroxisomal protein import is conserved between yeast, plants, insects and mammals. EMBO J 9:85–90 Hayashi M, Aoki M, Kato A, Kondo M, Nishimura M (1996) Transport of chimeric proteins that contain a carboxy-terminal targeting signal into plant microbodies. Plant J 10:225–234 Hayashi M, Toriyama K, Kondo M, Kato A, Mano S, De Bellis L, Hayashi-Ishimaru Y, Yamaguchi K, Hayashi H, Nishimura M (2000) Functional transformation of plant peroxisomes. Cell Biochem Biophys 32:295–304 Huang AHC, Trelease RN, Moore TS (1983) Plant peroxisomes. Academic Press, New York Jardim A, Liu W, Zheleznova E, Ullman B (2000) Peroxisomal targeting signal-1 receptor protein PEX5 from Leishmania donovani. J Biol Chem 275:13637–13644 Kato A, Hayashi M, Mori H, Nishimura M (1995) Molecular characterization of a glyoxysomal citrate synthase that is synthesized as a precursor of higher molecular mass in pumpkin. Plant Mol Biol 27:377–390 Kato J, Yamahara T, Tanaka K, Takio S, Satoh T (1997) Characterization of catalase from green algae Chlamydomonas reinhardtii. J Plant Physiol 151:262–268 Kehlenbeck P, Coyal A, Tolbert NE (1995) Factors affecting development of peroxisomes and glycolate metabolism among algae of different evolutionary lines of the Prasinophyceae. Plant Physiol 109:1363–1370 Komori M, Rasmussen SW, Kiel JA, Baerends RJ, Cregg JM, Klei IJV (1997) The Hansenula polymorpha PEX14 gene encodes a novel peroxisomal membrane protein essential for peroxisome biogenesis. EMBO J 16:44–53
585 Mano S, Nakamori C, Hayashi M, Kato A, Kondo M, Nishimura M (2002) Distribution and characterization of peroxisomes in Arabidopsis by visualization with GFP: dynamic morphology and actin-dependent movement. Plant Cell Physiol 43:331–341 Marzioch M, Erdmann R, Veenhuis M, Kunau WH (1994) PAS7 encodes a novel yeast member of the WD-40 protein family essential for import of 3-oxoacyl-CoA thiolase, a PTS2-containing protein, into peroxisomes. EMBO J 13:4908–4917 Matsuzaki M, Misumi O, Shin-i T, Maruyama S, Takahara M, Miyagishima S (2004) Genome sequence of the ultra-small unicellular red alga Cyanidioschyzon merolae 10D. Nature 428:653–657 McNew JA, Goodman JM (1996) The targeting and assembly of peroxisomal proteins, some old rules do not apply. Trends Biochem Sci 21:54–58 Motley AM, Hettema EH, Ketting R, Plasterk R, Tabak HF (2000) Caenorhabditis elegans has a single pathway to target matrix proteins to peroxisomes. EMBO Rep 1:40–46 Niwa Y, Hirano T, Yoshimoto K, Shimizu M, Kobayashi H (1999) Non-invasive quantitative detection and applications of nontoxic, S65T-type green fluorescent protein in living plants. Plant J 18:455–463 Olsen LJ, Harada JJ (1995) Peroxisome and their assembly in higher plants. Annu Rev Plant Physiol Plant Mol Biol 46:123–146 Rhodin J (1954) Correlation of ultrastructural organization and function in normal and experimentally changed proximal convoluted tubule cells of the mouse kidney. Doctorate Thesis. Karolinska Institutet, Stockholm Shimogawara K, Fujiwara S, Grossman A, Usuda H (1998) Highefficiency transformation of Chlamydomonas reinhardtii by electroporation. Genetics 148:1821–1828 Shinozaki A, Sato N, Hayashi Y (2009) Peroxisomal targeting signals in green algae. Protoplasma 235:57–66 Silverberg BA (1975a) 3, 30 -Diaminobenzidine (DAB) ultrastructural cytochemistry of microbodies in Chlorogonium elongatum. Protoplasma 85:373–376 Silverberg BA (1975b) An ultrastructural and cytochemical characterization of microbodies in the green algae. Protoplasm 83:269–295 Silverberg BA, Sawa T (1974) Cytochemical localization of oxidase activities with diamino benizidine in the green algae Chlamydomonas dysosmos. Protoplasm 81:177–188 Sizova I, Fuhrmann M, Hegemann PA (2001) Streptomyces rimosus aphVIII gene coding for a new type phosphotransferase provides stable antibiotic resistance to Chlamydomonas reinhardtii. Gene 277:221–229 Stabenau H (1974a) Verteilung von Microbody-Enzymen aus Chlamydomonas in Dichtegradienten. Planta 118:35–42 Stabenau H (1974b) Localization of enzymes of the glycolate metabolism in the alga Chlorogonium elongatum Dangeard. Plant Physiol 54:866–869 Stabenau H (1984) Microbodies in different algae. In: Wiessner W, Robinson D, Starr RC (eds) Compartments in algal cells and their interaction. Springer, Berlin, pp 183–190 Stabenau H, Sa¨ftel W (1981) Lokalisation von Enzymen des Glykolatstoffwechsels in Mougeotia. Ber Deutsch Bot Ges 94:59–64 Stabenau H, Winkler U, Saftel W (1993) Localization of glycolate dehydrogenase in two species of Dunaliella. Planta 191:362–364 Subramani S (1993) Protein import into peroxisomes and biogenesis of the organelle. Annu Rev Cell Biol 9:445–478 Szilard RK, Titorenko VI, Veenhuis M, Rachubinski RA (1995) Pay32p of the yeast Yarrowia lipolytica is an intraperoxisomal component of the matrix protein translocation machinery. J Cell Biol 131:1453–1469
123
586 Terlecky SR, Nuttley WM, McCollum D, Sock E, Subramani S (1995) The Pichia pastoris peroxisomal protein PAS8p is the receptor for the C-terminal tripeptide peroxisomal targeting signal. EMBO J 14:3627–3634 Van der Leij I, Franse MM, Elgersma Y, Distel B, Tabak HF (1993) PAS10 is a tetratricopeptide-repeat protein that is essential for
123
J Plant Res (2012) 125:579–586 the import of most matrix proteins into peroxisomes of Saccharomyces cerevisiae. Proc Natl Acad Sci USA 90:11782– 11786 Wimmer C, Schmid M, Veenhuis M, Gietl C (1998) The plant PTS1 receptor: similarities and differences to its human and yeast counterparts. Plant J 16:453–464