Dig Dis Sci (2012) 57:1253–1260 DOI 10.1007/s10620-012-2042-6

ORIGINAL ARTICLE

ZEB2 Promotes the Metastasis of Gastric Cancer and Modulates Epithelial Mesenchymal Transition of Gastric Cancer Cells Ying-Huan Dai • Ya-Ping Tang • Hong-Yi Zhu Liang Lv • Yi Chu • Yu-Qian Zhou • Ji-Rong Huo

•

Received: 7 October 2011 / Accepted: 4 January 2012 / Published online: 16 February 2012 Ó Springer Science+Business Media, LLC 2012

Abstract Background Invasion and metastasis are the hallmarks of advanced gastric cancer progression. Therefore, it is urgent to overcome metastasis in order to improve the survival of gastric cancer patients. Aims This study aimed to examine the expression of ZEB2 in gastric cancer samples and analyze its correlation with clinicopathologic features. In addition, the molecular mechanism by which ZEB2 contributes to gastric cancer metastasis will be explored. Methods ZEB2 expression in clinical gastric cancer samples was evaluated by immunohistochemical analysis. ZEB2 was knocked-down in HGC27 gastric cancer cells by shRNA and the effects on cell invasion and migration were examined by in vitro cell invasion and migration assays. The expression of epithelial marker E-cadherin, mesenchymal markers fibronecin and vimentin, and MMPs was detected by western blot analysis. Results The expression of ZEB2 was positively correlated with the depth of invasion, lymph node metastasis and TNM stage. In addition, patients with positive ZEB2 expression showed a significantly shorter overall survival time than did patients with negative ZEB2. shRNA mediated knockdown of ZEB2 resulted in reduced invasion and migration of HGC27 cells, along with the upregulation of E-cadherin and downregulation of fibronecin, vimentin, MMP2, and MMP9.

Y.-H. Dai  Y.-P. Tang  H.-Y. Zhu  L. Lv  Y. Chu  Y.-Q. Zhou  J.-R. Huo (&) Department of Gastroenterology, Second Xiangya Hospital of Central South University, Changsha 410011, Hunan Province, China e-mail: [email protected]

Conclusions ZEB2 expression is closely associated with the clinicopathological parameters of gastric cancer. ZEB2 promotes gastric cancer cell migration and invasion at least partly via the regulation of epithelial-mesenchymal transition. ZEB2 is a potential target for gene therapy of aggressive gastric cancer. Keywords ZEB2  Gastric cancer  Migration  Invasion  Epithelial-mesenchymal transition

Introduction Gastric cancer (GC) is one of the most common cancers and the major cause of cancer death in the world [1, 2]. Despite recent advances in diagnostics and treatments, most patients are diagnosed with advanced gastric cancer and the survival rate remains unsatisfactory. Invasion and metastasis are the hallmarks of advanced gastric cancer progression. Therefore, it is urgent to overcome GC metastasis in order to improve the survival of GC patients. There is mounting evidence that aberrant activation of epithelial-mesenchymal transition (EMT) is crucially involved in cancer invasion and metastasis [3–5]. EMT is a process of the formation of motile and invasive mesenchymal cells from polarized and adherent epithelial cells [3]. During EMT, the loss of intercellular adhesion and the gain of migratory and invasive properties allow tumor cells to detach from each other and invade into surrounding tissues. Some major transcriptional regulators have been implicated in the EMT, including the snail family (Snail1/ Snail, Snail2/slug), the basic helix-loop-helix (bHLH) factors (E47 and Twist), and the zinc finger proteins ZEB1 and SIP1/ZEB2 [6–12].

123

1254

ZEB2, also known as Smad-interacting protein 1 (SIP1), belongs to the zinc finger E-box binding protein (ZEB) family. ZEB2 plays an important role in the EMT during embryonic development as indicated by the phenotypes of the ZEB2 knockout mouse [13]. Down-regulation of ZEB2 expression leads to the loss of the migratory behavior of neural crest cells and the delamination arrest of cranial neural crest cells. ZEB2 has been well demonstrated to bind the E-cadherin promoter and suppress the expression of this cell–cell adhesion molecule [11]. Apart from E-cadherin, ZEB2 also directly represses the expression of the tight junction proteins, the desmosome proteins and the gap junctions in a coordinated fashion [14]. In addition, ZEB2 overexpression protects bladder cancer cells from DNA damage-induced apoptosis with important implications for bladder tumor progression [15]. In a number of clinical studies, up-regulation of ZEB2 mRNA has been detected in various cancers including gastric tumors [16, 17], ovarian carcinoma [18, 19], bladder cancer [16], pancreatic tumors [20], and oral squamous cell carcinomas [21], and ZEB2 mRNA level is generally correlated to tumor metastasis, differentiation grade and poor prognosis. Taken together, these data establish ZEB2 as a critical regulator in promoting EMT and tumor progression. Although ZEB2 has been found to be upregulated in GC, the functional role of ZEB2 in GC remains largely unexplored. In the present study, we first examined ZEB2 expression in GC clinical specimens and analyzed the correlation of ZEB2 expression with clinicopathologic features. Next we employed shRNA to knockdown ZEB2 in the GC cell line to examine the effects on cell migration and invasion and explore the potential mechanism by which ZEB2 regulates EMT in GC cells.

Materials and Methods Patients and Specimens Paraffin embedded sections of 76 gastric carcinomas and 21 normal gastric tissues were obtained from the Department of Pathology, Second Xiangya Hospital, Central South University, from January 2005 to May 2006. There were 50 males and 26 females with a mean age of 53.8 years (range 31–88 years). All patients with welldocumented clinical histories and follow-up information were histologically proven to have gastric adenocarcinoma, without radiotherapy or chemotherapy before the operation. Of the 76 gastric cancer specimens, 13 were well differentiated adenocarcinomas, 15 moderately differentiated, and 48 poorly differentiated. Stage of GC was defined according to the 2009 tumor-node-metastasis (TNM) classification of the International Union Against Cancer

123

Dig Dis Sci (2012) 57:1253–1260

[22]. All patients were followed-up until January 2011 either by telephone or mail. The median follow-up period was 40 months (range 3–70 months). Twenty-one normal gastric tissues from patients who underwent partial gastrectomy for benign gastric diseases were also included in this study. The study was approved by the Ethics Committee of Central South University and informed consent was obtained from all of the patients. Immunohistochemical Methods Specimens, fixed in 10% buffered formalin and embedded in paraffin, were cut into 4-lm thick sections. The sections were deparaffinized and rehydrated before incubation for 10 min with 3% hydrogen peroxide solution. Antigen retrieval was performed in citrate buffer (pH 6.0) in a microwave oven for 15 min at 100°C. Then the sections were incubated with rabbit ZEB2 polyclonal antibody (1:100, ab25837; Abcam, Cambridge, UK) at 4°C overnight in a humidified chamber. The immunohistochemical staining was performed with the PowerVision two-step histostaining reagent and 3,30 -diaminobenzidine tetrahydrochloride substrate kit (Zhongshan Goldenbridge Biotechnology, Beijing, China) following the manufacturer’s instructions. Finally, the sections were counterstained with hematoxylin, dehydrated, and mounted. For the negative controls, PBS was used to substitute primary antibody. Evaluation of Immunostaining The sections were evaluated by two independent pathologists who had no prior knowledge of the clinical and molecular variables. For ZEB2 staining, both the staining intensity and the percentage of stained cells were considered. Staining intensity was scored as follows: 0, no staining; 1, weak; 2, moderate; 3, strong. Percentage of staining cells was scored as follows: 0,\5%; 1,[5–25%; 2, [25–50%; 3, [50–75%; 4, [75% of the cells in the respective lesions. The final score was achieved by multiplying the intensity value and the percentage value (ranging 0–12) [23]. The samples were judged as follows: negative (final scores, \4) and positive (final score, C4). Cell Culture and Transfection Human gastric carcinoma cell line HGC27 was purchased from the cell culture center of Xiangya Medical College, Central South University. Cells were cultured in RPMI 1640 medium (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum and incubated at 37°C in a 5% CO2 humidified atmosphere. pGPU6/GFP/Neo-shRNA plasmid targeting ZEB2 (shZEB2) was constructed by Shanghai JIMA Biologic Co., China. The ZEB2-specific

Dig Dis Sci (2012) 57:1253–1260

shRNA sequence was as follows: sense 5-CACCG CATGTATGCATGTGACTTATTTCAAGAGAATAAGT CACATGCATACATGCTTTTTTG-3; antisense 5-GATC CAAAAAAGCATGTATGCATGTGACTTATTCTCTTG AAATAAGTCACATGCATACATGC-3. pGPU6/GFP/Neo plasmid-shNC (shNC) was used to express nonsense shRNA and served as negative control. Cell transfection was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Briefly, 4 lg of shZEB2 or shNC plasmid was mixed with 10 ll of transfection reagent and the mixture was added into 2 ml RPMI1640 medium per well of a 6-well plate at about 70–80% cell confluence. Six hours later, cells were re-fed with fresh medium and continued for culture. The cells were analyzed by fluorescence microscopy to examine the efficiency of transfection 24 h after transfection. Cells were collected for the following assay after 24 h or for RNA and protein extraction after 48 h. Real-Time Quantitative Polymerase Chain Reaction Cells were lysed in Trizol reagent (Invitrogen, Carlsbad, CA) and total RNA was prepared according to the manufacturer’s instructions. Two micrograms of RNA were TM converted into cDNA using RevertAid First Strand cDNA Synthesis Kit (MBI Fermentas). Real-time quantitative PCR analysis was performed using SYBR Premix Ex Taq II (TaKaRa, Dalian, China). b-actin was used as an internal control. The primers for b-actin were 50 -TTC CAGCCTTCCTTCCTGGG-30 (sense) and 50 -TTGCGCTC AGGAGGAGCAAT-30 (antisense). The primers for ZEB2 were 50 -CAAGGAGCAGGTAATCGCAAGT-30 (sense) and 50 -GGAACCAGAATGGGAGAAACG-30 (antisense). All reactions were done in triplicate, independently repeated at least three times and the average was calculated. For relative quantification, 2-DDCt was calculated and used as an indication of the relative expression levels. Western Blotting Cell lysates were prepared and separated by SDS-PAGE gel and transferred to polyvinylidene difluoride membrane. After blocking with 5% non-fat dry milk in Tris buffered saline (TBS, pH 7.4), the membranes were incubated with primary antibody overnight at 4°C. After several washing steps with TBS, the membranes were incubated with appropriate secondary horseradish peroxidase-conjugated antibodies (1:5,000; Proteintech, Chicago, IL, USA) for 1 h at room temperature. The bands were detected using the enhanced chemiluminescence (ECL) method (Thermo Scientific Pierce, Rockford, IL, USA). The primary antibodies and their final dilutions were as follows: ZEB2 (1:800, ab25837; Abcam), E-cadherin (1:500, sc-7870;

1255

Santa Cruz Biotechnology, Santa Cruz, CA, USA), Fibronectin (1:1,000, 1573-1; Epitomics, Burlingame, CA, USA), Vimentin (1:800, ab8979; Abcam), MMP2 (1:500, sc-373914; Santa Cruz Biotechnology), MMP9 (1:200, sc-6841; Santa Cruz Biotechnology), and actin (1:500, sc-10731; Santa Cruz Biotechnology). Transwell Invasion Assay A Transwell membrane (8-lm pore size, 6.5-mm diameter; Corning Costar, Cambridge, MA, USA) coated with Matrigel (BD Biosciences, Bedford, MA, USA) was used for invasion assay. HGC27 cells were transfected with shZEB2 and shNC plasmids; 24 h later the cells were trypsinized, washed and resuspended in serum-free medium and added at a density of 5.0 9 104 to the upper chamber of precoated transwells. The lower chamber of the transwells contained the same medium with 10% FBS. After incubation for 24 h, the cells on the upper chamber were swabbed with a cotton-tipped swab. The invasive cells, which were attached to the lower surface of the membrane, were fixed with methanol and stained with 0.1% Crystal violet (Sigma, St. Louis, MO, USA). The number of invasive cells (five fields per filter) was counted under an inverted microscope and the mean numbers of invasive cells were calculated. These experiments were performed in triplicate and repeated three times. Transwell Migration Assay A Transwell membrane (8-lm pore size, 6.5-mm diameter; Corning Costar) was used for migration assay. The experimental procedures were similar to the Transwell invasion assay except that the time of incubation was 12 h. Statistical Analysis Results were analyzed by SPSS17.0 software and expressed as mean ± SD. The v2 test, Spearman rank test, and one-way ANOVA were used for statistical analysis. Survival curves were plotted with the Kaplan–Meier method and differences between survival curves were analyzed by log-rank test. Independent prognostic factors were analyzed using the Cox proportional hazard model. A value of P \ 0.05 was considered statistically significant.

Results The Correlations Between ZEB2 Expression and Clinicopathological Parameters of GC Patients Immunohistochemical staining showed that ZEB2 protein was diffusely localized in the cytoplasm. The positive rate

123

1256

Dig Dis Sci (2012) 57:1253–1260

Fig. 1 Immunohistochemical staining of ZEB2 in GC and normal gastric mucosa (9200). a Positive expression of ZEB2 in GC. b Negative expression of ZEB2 in normal gastric mucosa

of ZEB2 expression is 59.2% (45/76) in GC and 19.0% (4/21) in normal gastric mucosa (Fig. 1). A significant difference was found in the expression of ZEB2 protein between GC and normal gastric mucosa (P \ 0.01). Next we analyzed the correlations between ZEB2 expression and clinicopathological parameters of GC patients. As shown in Table 1, ZEB2 expression was correlated closely with the depth of invasion (P = 0.038), lymph node metastasis (P = 0.006), TNM stage (P = 0.003), but not with patients’ age, gender, tumor size and differentiation (P [ 0.05). Kaplan–Meier method with log-rank test revealed that patients with positive ZEB2 expression had a significantly lower post-operative survival rate than those with negative expression (P = 0.011, Fig. 2). Tumor size, differentiation, depth of invasion, lymph node metastasis and ZEB2 expression which revealed prognostic significance in univariate analysis were entered into a Cox regression model for multivariate analysis. Depth of invasion (P \ 0.01) and lymph node metastasis (P \ 0.01) were independent prognostic factors, but the expressions of ZEB2 had no prognostic significance in multivariate analysis. ShRNA Mediated Knockdown of ZEB2 in HGC27 Cells To investigate the functional role of ZEB2 in GC, first we used shRNA to specifically knockdown ZEB2 expression in HGC27 GC cells. shZEB2 and the control shNC plasmids were successfully transfected into HGC27 cells. The levels of ZEB2 mRNA and protein expression were analyzed by quantitative real-time PCR and western blotting. The results showed that ZEB2 expression at both mRNA and protein levels was successfully knocked down by shZEB2 but not by control shNC (Fig. 3).

123

Table 1 Correlation between ZEB2 and clinicopathological features of gastric cancer (GC) Factors

n

ZEB2 expression Positive

P value

Negative

Age (years) \60

52

31

21

C60 Gender

24

14

10

Female

26

15

11

Male

50

30

20

0.916

0.846

Tumor size (cm) \5

40

21

19

C5

36

24

12

Moderate or well

28

15

13

Poor

48

30

18

0.21

Differentiation 0.445

Depth of invasion T1 ? T2

22

9

13

T3 ? T4

54

36

18

Negative

30

12

18

Positive TNM stage

46

33

13

I ? II

36

15

21

III ? IV

40

30

10

0.038

Lymph node metastasis 0.006

0.003

ZEB2 Knockdown Inhibits the Invasion and Migration of HGC27 Cells Next we investigated the effects of ZEB2 knockdown on the biological behaviors of HGC27 cells. In vitro cell invasion and migration assays showed that ZEB2

Dig Dis Sci (2012) 57:1253–1260

1257

ZEB2 Regulates the Expression of EMT Markers in HGC27 Cells To explore the molecular mechanism by which ZEB2 promotes gastric cancer cell invasion and migration, we performed western blotting analysis to examine the expression of mesenchymal markers such as vimentin and fibronectin and several proteins involved in EMT such as MMP2, MMP9 and E-cadherin. The results showed that ZEB2 knockdown in HGC27 cells led to significant downregulation of the expression of vimentin, fibronectin, MMP2 and MMP9, but significant upregulation of E-cadherin expression (Fig. 6). These data indicate that ZEB2 modulates EMT of gastric cancer cells.

Fig. 2 Survival curves with positive and negative ZEB2 expression in gastric cancer (GC) (P \ 0.05)

Fig. 3 ShRNA mediated knockdown of ZEB2 in HGC27 cells. a Quantitative real-time PCR analysis of ZEB2 expression in each group. The relative quantification of ZEB2 mRNA was calculated according to 2-DDCt, [DDCt = (CtZEB2 - Ctb-actin) experimental group - (CtZEB2 - Ctb-actin) HGC27 group] and shown in the bar graphs. b Western blotting analysis of ZEB2 protein expression in each group

knockdown in HGC27 cells resulted in significant inhibition of cell invasion (Fig. 4, P \ 0.05 compared to control) and cell migration (Fig. 5, P \ 0.05 compared to control). These results suggest that ZEB2 promotes the invasion and migration of gastric cancer cells.

Discussion ZEB2, a member of the ZEB family, is characterized by a homeodomain flanked by two separate, highly conserved clusters of C2H2 (Kruppel)-type zinc fingers at the COOH and NH2 terminus, by which ZEB2 binds E-box-like sequences (CACCTG) on target DNAs [24]. Upregulation of ZEB2 has so far been implicated in different types of tumor. For example, ZEB2 plays an important role in the invasion of ovarian cancer and serves as a prognostic factor [19]. Similar findings were observed in oral carcinoma and pancreatic cancer [20, 21]. In this study, we found that the ZEB2 protein was highly expressed in GC (59.2%) compared with normal mucosa (19.0%). This is in accordance with previous reports in which ZEB2 overexpression was detected in GC by PCR [16, 17]. Furthermore, we found that the increased protein expression of ZEB2 was closely associated with the depth of invasion, lymph node metastasis, and TNM stage in patients with GC. Notably, the expression level of ZEB2 protein was significantly correlated with overall survival although ZEB2 was not a potential prognostic factor in multivariate analyses. These results suggest that enhanced expression of ZEB2 might play an important role in the progression and metastasis of GC. A central event in EMT is the loss of E-cadherin, which is a cell–cell adhesion molecule that participates in homotypic, calcium-dependent interactions to form epithelial adherent junctions [25]. The loss of E-cadherin expression enables carcinoma cells to dissociate and migrate from the primary site and facilitates migratory and invasive behaviors [3]. Inactivation or downregulation of E-cadherin expression is mediated by several mechanisms such as gene mutations, promoter hypermethylation, post-translational modification and transcriptional repression [26–29]. Among them, transcription

123

1258

Dig Dis Sci (2012) 57:1253–1260

Fig. 4 Invasion assay in HGC27 cells (9200). a shZEB2-HGC27. b shNCHGC27. c HGC27. d Diagrams are representative of at least three independent experiments. In invasion analysis, transfection of shZEB2 reduced the invasive capabilities of HGC27 cells, when compared to the HGC27 and shNC-HGC27 cells

repression plays a crucial regulatory role. ZEB2 directly repress E-cadherin expression by binding to the conserved E-boxes (CACCTG) in the E-cadherin promoter [11, 24]. Interestingly, the negative correlation between ZEB2 and E-cadherin expression is found in several types of epithelial cancers comprising gastric cancer [16], ovarian cancer [19] and pancreatic cancer [20]. Further studies showed that conditional expression of ZEB2 in epithelial MDCK cells significantly downregulated E-cadherin expression and simultaneously induced the cell invasion in vitro [11], while ZEB2 knockdown in ovarian adenocarcinoma SKOV3 cells induced E-cadherin re-expression [19]. In agreement with previous studies, we found that RNAi mediated downregulation of ZEB2 in HGC27 cells resulted in the induction of E-cadherin associated with significantly reduced cell migration and invasion. Besides the E-cadherin, the gain of mesenchymal markers such as vimentin, fibronecin, N-cadherin and members of the matrix metalloproteases (MMP) family also play an important role in tumor invasion and metastasis. Bindels et al. reported that ZEB2 could regulate vimentin expression and promote the migration of

123

epithelial breast tumor cells [30]. ZEB2-dependent upregulation of MMP-1, MMP-2 and MT1-MMP mRNA and reduction of E-cadherin were shown in hepatocellular carcinoma cells [31]. In glioma, ZEB2 overexpression promoted tumor cell migration and invasion associated with the repression of E-cadherin and increased expression of mesenchymal proteins such as fibronectin and vimentin [32]. Similarly, in the present study the repression of fibronecin, vimentin, MMP2 and MMP9 expression following ZEB2 shRNA transfection was shown in HGC27 gastric tumor cells, suggesting that ZEB2 may promote gastric cancer cell migration and invasion partly via the modulation of EMT. However, the mechanism by which ZEB2 activates the expression of mesenchymal proteins needs to be elucidated in further studies. In conclusion, our immunohistochemical analysis demonstrates that ZEB2 expression was closely associated with the clinicopathological parameters of gastric cancer. Our in vitro experiments showed that ZEB2 knockdown reduced gastric cancer cell migration and invasion accompanied by the changed expression of EMT-related genes. Our data suggest that ZEB2 is a potential target for gene therapy of aggressive gastric cancer.

Dig Dis Sci (2012) 57:1253–1260

1259

Fig. 5 Migration assay in HGC27 cells (9200). a shZEB2-HGC27. b shNCHGC27. c HGC27. d Diagrams are representive of at least three independent experiments. In migration assay, the cells transfected with shZEB2 demonstrated an impaired migration capacity when compared to the HGC27 and shNC-HGC27 cells

Fig. 6 The alterations of downstream proteins by reduction of ZEB2 in HGC27. ZEB2 reduction induced expression of E-cadherin and downregulates expression of fibronectin, vimentin, MMP2 and MMP9 Acknowledgments The research was supported by the Project of Science and Technology Bureau of Hunan Province, China (2011FJ6025). Conflict of interest

None.

References 1. Catalano V, Labianca R, Beretta GD, Gatta G, de Braud F, Van Cutsem E. Gastric cancer. Crit Rev Oncol Hematol. 2005;54:209–241.

2. Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010;127:2893–2917. 3. Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer. 2002;2:442–454. 4. Cardiff RD. Epithelial to mesenchymal transition tumors: fallacious or snail’s pace? Clin Cancer Res. 2005;11:8534–8553. 5. Thompson EW, Newgreen DF, Tarin D. Carcinoma invasion and metastasis: a role for epithelial-mesenchymal transition? Cancer Res. 2005;65:5991–5995. 6. Batlle E, Sancho E, Franci C, et al. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol. 2000;2:84–89. 7. Cano A, Perez-Moreno MA, Rodrigo I, et al. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol. 2000;2:76–83. 8. Hajra KM, Chen DY, Fearon ER. The SLUG zinc-finger protein represses E-cadherin in breast cancer. Cancer Res. 2002;62: 1613–1618. 9. Vernon AE, LaBonne C. Tumor metastasis: a new twist on epithelial-mesenchymal transitions. Curr Biol. 2004;14:R719–R721. 10. Perez-Moreno MA, Locascio A, Rodrigo I, et al. A new role for E12/E47 in the repression of E-cadherin expression and epithelial-mesenchymal transitions. J Biol Chem. 2001;276:27424– 27431. 11. Comijn J, Berx G, Vermassen P, et al. The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Mol Cell. 2001;7:1267–1278. 12. Eger A, Aigner K, Sonderegger S, et al. DeltaEF1 is a transcriptional repressor of E-cadherin and regulates epithelial plasticity in breast cancer cells. Oncogene. 2005;24:2375–2385.

123

1260 13. Van de Putte T, Maruhashi M, Francis A, et al. Mice lacking Zfhx1b, the gene that codes for Smad-interacting protein-1, reveal a role for multiple neural crest cell defects in the etiology of Hirschsprung disease-mental retardation syndrome. Am J Hum Genet. 2003;72:465–470. 14. Vandewalle C, Comijn J, De Craene B, et al. SIP1/ZEB2 induces EMT by repressing genes of different epithelial cell–cell junctions. Nucleic Acids Res. 2005;33:6566–6578. 15. Sayan AE, Griffiths TR, Pal R, et al. SIP1 protein protects cells from DNA damage-induced apoptosis and has independent prognostic value in bladder cancer. Proc Natl Acad Sci USA. 2009;106:14884–14889. 16. Rosivatz E, Becker I, Specht K, et al. Differential expression of the epithelial-mesenchymal transition regulators snail, SIP1, and twist in gastric cancer. Am J Pathol. 2002;161:1881–1891. 17. Ohta H, Aoyagi K, Fukaya M, et al. Cross talk between hedgehog and epithelial–mesenchymal transition pathways in gastric pit cells and in diffuse-type gastric cancers. Br J Cancer. 2009;100: 389–398. 18. Elloul S, Elstrand MB, Nesland JM, et al. Snail, Slug, and Smadinteracting protein 1 as novel parameters of disease aggressiveness in metastatic ovarian and breast carcinoma. Cancer. 2005;103:1631–1643. 19. Yoshihara K, Tajima A, Komata D, et al. Gene expression profiling of advanced-stage serous ovarian cancers distinguishes novel subclasses and implicates ZEB2 in tumor progression and prognosis. Cancer Sci. 2009;100:1421–1428. 20. Imamichi Y, Konig A, Gress T, Menke A. Collagen type I-induced Smad-interacting protein 1 expression downregulates E-cadherin in pancreatic cancer. Oncogene. 2007;26:2381–2385. 21. Maeda G, Chiba T, Okazaki M, et al. Expression of SIP1 in oral squamous cell carcinomas: implications for E-cadherin expression and tumor progression. Int J Oncol. 2005;27:1535–1541.

123

Dig Dis Sci (2012) 57:1253–1260 22. Sobin LH, Gospodarowicz MK, Wittekind C. UICC TNM classification of malignant tumours. 7th ed. New York: WileyBlackwell; 2009. 23. Li YZ, Zhao P, Han WD. Clinicopathological significance of LRP16 protein in 336 gastric carcinoma patients. World J Gastroenterol. 2009;15:4833–4837. 24. Verschueren K, Remacle JE, Collart C, et al. SIP1, a novel zinc finger/homeodomain repressor, interacts with smad proteins and binds to 50 -CACCT sequences in candidate target genes. J Biol Chem. 1999;274:20489–20498. 25. Cowin P, Rowlands TM, Hatsell SJ. Cadherins and catenins in breast cancer. Curr Opin Cell Biol. 2005;17:499–508. 26. Hajra KM, Fearon ER. Cadherin and catenin alterations in human cancer. Genes Chromosom Cancer. 2002;34:255–268. 27. Rashid MG, Sanda MG, Vallorosi CJ, Rios-Doria J, Rubin MA, Day ML. Posttranslational truncation and inactivation of human E-cadherin distinguishes prostate cancer from matched normal prostate. Cancer Res. 2001;61:489–492. 28. Guilford P, Hopkins J, Harraway J, et al. E-cadherin germline mutations in familial gastric cancer. Nature. 1998;392:402–405. 29. Van Aken E, De Wever O, Correia da Rocha AS, Mareel M. Defective E-cadherin/catenin complexes in human cancer. Virchows Arch. 2001;439:725–751. 30. Bindels S, Mestdagt M, Vanderwalle C, et al. Regulation of vimentin by Sip1 in human epithelial breast tumor cells. Oncogene. 2006;25:4975–4985. 31. Miyoshi A, Kitajima Y, Sumi K, et al. Snail and SIP1 increase cancer invasion by upregulating MMP family in hepatocellular carcinoma cells. Br J Cancer. 2004;90:1265–1273. 32. Xia M, Hu M, Wang J, et al. Identification of the role of Smad interacting protein 1 (SIP1) in glioma. J Neurooncol. 2010;97: 225–232.